Week 12

Note correction to quiz 5 question 3

AACGTATGCCAATGATAGCTAGGAGATAAAAAACG

replace all U's with T's

Chapter 15

Chromosomes themselves don’t change in gross (large) ways quickly- that is they don’t change from cell to cell. they are totipotent- any complete nucleus can give rise to any specific cell. So then how does a cell know it is supposed to become a liver cell or a brain cell. recall from your basic biology that organisms start as a single cell which then grows and divides-- during the developmental process cells differentiate and become specialized.

Drosophila

oocyte surrounded by 15 nurse cells

fertilization

13 cell divisions- 3.5 hours forming a syncitium (nuclei without cell membranes) membranes form and a blastoderm is formed

gastrulation-

form segments called parasegments

fully segmented embryo has an anterior tip--- acron, anterior region (head) three thorasic segments ; eight abdominal segments; posterior region; posterior tip- telson

So how does the embryo know to make these segments and what makes these segments develop into the body parts they are going to be?

Genes! and careful regulation of gene expression

How did we figure this all out?

MUTANTS!!!!

A mutant without a head was discovered--- through careful work it was determined that a gene called biciod was responsible. How was this confirmed? An embryo with bicoid missing had bicoid cytoplasm from a normal embryo containing mRNA added and voila the fly got a head! The bicoid gene makes a protein called Bicoid it is a morphogen ( a substance that diffuses through the egg and determines the developmental fate of that part of the embryo) MATERNAL cells NOT the embryo produce this protein so it is a maternal effect gene.

once bsic body plan is in place a more fine scale set of differentiation takes place- organs are produced and this all occurs under the zygotes control- segment genes

These genes are activated sequentially- each set is activated by the set previous and activates the next set. Gap-genes; pair-rule genes; segment polarity genes

most segment genes are... transcription factors! They create a developmental cascade!

Homeotic genes-

in homeotic mutants one set of cells follows the developmental pathway that would normally be followed by another set of cells- demonstrations- fly with a leg on it’s head (antennapedia) or an eye on it’s body or two sets of wings( bithorax)

http://www-nmr.cabm.rutgers.edu/~gardino/page20.html

http://www.csa.ru:81/Inst/gorb_dep/inbios/genet/s1antp.htm

The homeo box- a conserved sequence of 180 base-pairs of DNA on all of the homeotic genes-

http://bioweb.ncsa.uiuc.edu/educwb/tutorials/dros/links.html

Are Drosophila the only ones who regulate development and have homeotic genes?

NO!

Homeoboxes have been found in plants, yeast, sea urchins, and humans among others

The homeobox sequence is translated into 60 amino acids that function by binding to DNA

read the box on pages 434-435 !

Signal transduction

a signal turns on a set of genes (i.e. lactose)

focus on purdue

http://www.bio.purdue.edu/Bioweb/people/faculty/Hasson.html

go to CD

Plants---

floral development is being studied in Arabadopsis thaliana

There are homeotic genes involved here too!

So these are just examples of ways to regulate gene expression there are other ways that expression can be regulated-

methylation and Z DNA

methylated DNA has a much harder time being transcribed as does Z-DNA

transposons-- we are back to transposons- read about ac-ds in the book and about yeast mating

immunogenetics

phages and bacteria can invade cells but the invadee can and does fight back. The interaction between the invader and invadee is often referred to as host/parasite interaction and we will be talking more about this later.

In mammals there are two kinds of cells that are involved in frontline defenses against invasion- B-cells and T-cells. The very first step is the recognition that there is something "foreign" or other going on. This is then an immune response and is caused by antigens.

B-cells produce specific proteins called antibodies of immunoglobins. These can 1) coat antigens so they can be engulfed by phagocytes 2) combine with antigens and block their ability to function 3)self destruct taking the antigen with it

T-Cells attack host cells that have been infected by virus, bacterium or whatever, they attack and destroy that cell they recognize infected cells by receptors on the surface of the cell- one MHC or major histocompatability complex is on the surface and produces a part of the antigen on the surface.

So where's the genetics? Well genes are responsible for the structure of proteins involved in the host response. In this case you have antigen "recognition" which is binding between the T-Cell and the MHC the recognition involves protein conformation or shape- protein shape is a function of AA sequence which is a function of …..

DNA sequence.

In this case we need flexibility on the part of the B/T cells - an ability to recognize classes of antigens not just one single antigen.

B cells

B cells produce immunoglobins, T cells recognize antigens on the MHC

immunoglobins have two main parts a "fixed" piece and a "variable" piece. The variable piece recognizes the antigen. People have the ability to recognize up to 10⁶ different antigens… do we have 10⁶ different gene's just for this function? Ditto for the T-cells

We have the ability to combine different pieces together-- there are fewer genes but more combinations

Think about those probability trees and combining loci together…

This is all an oversimplification of the process --

Cancer

abnormal cell proliferation- or cell division gone wild. All cancer's are genetic in the sense that they arise from alterations in genes that control cell growth and they are clonal for the most part- that is arising from a single abberant cell. So how does a regular cell minding it's own business change and become a cancer cell?

The question of the hour…

mutation- somehow during cell division there is a mutation that makes things become cancerous. Or some people carry a mutation or variant of an allele that when it comes in contact with a certain environmental trigger (cigarette smoke) causes cancer.

oncogenes-genes that when relocated to a new cell cause cancer

Using pedigree analysis to locate genetic similarities among relatives who have cancer.

Breast cancer- BRCA1, BRCA2

http://www.uwcm.ac.uk/uwcm/mg/ns/7/126611.html

Problems with cell cycle causing it to go wild- or problems with recognition and prevention of cancerous growth

Wilm's tumor

http://www-medlib.med.utah.edu/WebPath/RENAHTML/RENAL057.html

renal tumor associated with loss of band p13 on chromosome 11. Most people affected are children and have lost part of Xsome 11 from their mothers

p53

the most common mutation observed in all cancers

is a transcription factor that binds to at least 8 genes causing increase in transcription of these genes these genes have three general functions: cell cycle stoppage, programmed cell death apoptosis, self repressor

Also some viruses carry oncogenes-- nasty

How are oncogenes turned on ?

What about the environment?

exposure to nuclear meltdown Chernobyl,

smoking

focus on Purdue

http://www.bio.purdue.edu/Bioweb/people/faculty/Franklin.html

http://www.bio.purdue.edu/Bioweb/people/faculty/Taparowsky.html

Chapter 16

mutation- the process by which DNA changes and the result of that change

mutation is often "negative" when it refers to the result of the change but it doesn't have to be and it is not negative at all when referring to the process of change

a mutant is an individual that has some obvious phenotypic difference (usually defect) from the "wild type"

If two mutations appear that produce the same phenotype are they the result of the same change in the DNA?

Maybe-

let's think about that operon system -- a change in the operator sequence or the repressor sequence could cause failure to bind efficiently so here is an example of two different possible ways to end up with the same phenotype- never turning on a gene or failure to ever turn it off (depending on the way the repressor works)

what we would try to do then is determine whether mutations were allelic- that is different alleles for the same gene so the question is: are these mutations allelic?

If the two recessive mutations are allelic and I combine them (using crosses) into a single individual then the phenotype should be mutant. If they are not allelic then when I cross them the individual should be wild-type or normal

a-a- x b-b-

allelic a-b- phenotype is -

nonallelic a-a b-b phenotype is +

In the case of non allelic we say that the mutations complement each other and the process for determining allelism is called a complementation test.

If they are found to be allelic are they actually mutations at the same locus?

If a large number of progeny are created from the F1 by selfing all F2's are still - that means that there was no observable recombination between loci -> this looks like it might be the same locus if some are + that means there was recombination and the loci are not the same

Is there another way to do this today using what we know from Ch 12?

We could just sequence the mRNA! We would have an example of a wildtype then the two mutants in question and we could see whether the same change was observed.

Read on your own about S. Benzer

mutant screen- mutations are chemically induced and investigators look for phenotypic changes this is a departure from history- historically mutations were just observed as a natural occurrence.

What kind of mutations are possible?

Insertion (extra base or bases added)

deletion (base or bases deleted)

mutation- change from one base to another

Will all mutations result in a change in the amino acid sequence?

NO

if it is a change in the third position and still codes for the same amino acid then we have a change in the DNA but not the AA

Will all changes in the AA sequence result in phenotypic changes for the organism?

NO

if the AA is similar or is in a less important area of the protein (not a binding site) then the mutation may not have a phenotypic effect

so these mutations are neutral (remember this for later)

However, if we start with a phenotypic change we can be pretty sure that the amino acids have changed significantly because if they hadn't it wouldn't have shown up on the mutant screen.

mutation rate is the number of mutations that arise per cell division (bacteria) per gamete

if the mutation is an insertion or a deletion what happens?

If this occurs in a coding region and is not a multiple of three then we get a frame shift!

I this is the coding strand

AACGTATG CCA ATG ATA GCT AGG AGA TAA AAA ACG

then the spaces indicate the reading frame for amino acids

now if two bases are deleted

AACGTATG CCA ATG ATA GCT AGG AGA TAA AAA ACG

the frame shifts to

AACGTATG CCT GAT AGC TAG GAG ATA AAA AAC G

and the entire amino acid sequence after the deletion changes!

The same kind of thing happens with an insertion

With a point mutation we potentially but not necessarily have a single change in the AA content

AACGTATG CCA ATG ATA GCT AGG AGA TAA AAA ACG

G G

T U

C C

all code for proline A and G code stop but U and C code Tyrosine

What is the larger consequence of changing a stop codon to an Amino Acid?

What if an Amino acid is changed to a stop codon?

Changing one AA to another is a missense mutation changing an AA to a stop or a stop to an AA is nonesense mutation.

If Adenine is replaced by Guanine we have a transitional mutation a purine replaces a purine.

If adenine is replaced by Thymine we have a transversional mutation a purine is replaced by a pyrimidine.

The entire peptide gets longer

Over time the same base might mutate more than once and might "revert" to the original sequence in this case we say we have a back mutation.

We might also have complementary mutations (the book calls them intragenic supression)

here is an example: we have a mutation in a binding site that shifts the conformation of the binding site so that it isn't as efficient as it was. If we then see a second mutation in a different AA that allows the shape of the binding site to return to "normal" we have had a complementary mutation.

Or if we see a change in the enzyme being bound that changes it's shape and allows it to bind to the new shape of the binding site- also a complementary mutation intergenic supression in the book

Some mutations are lethal - if you get it you die some mutations are conditionally lethal, if you get it you die if the environment is a particular way.

So how would these mutations come about? Physically, Chemically, and/or naturally

Physically- X rays, UV light, neutrons

Chemically- mutagenic agents, EMS (ethyl,methyl sulfonate),DMS (dimethyl sulfonate), bleomycin,

aside spinach and fish- the combination of spinach and fish generates nitrosamines. Nitrosamines are MUTAGENIC AGENTS!

naturally- misalignment, DNA polymerase error (remember we talked about proofreading)

So mutations happen -- now what

DNA repair!

DNA mutation may cause distortion in the double helix. There are various ways this distortion is detected and repaired.

UV radiation tends to produce dimerization or linkage of adjacent pyrimidines in DNA C-T, C-C, T-T

T-T is the most frequent simerization produced. In e. coli there is an enzyme DNA photolysas that binds in the dark to dimerized thymines then when light is on the enzyme breaks the dimer bonds (repair) and falls free of the DNA this photoreactivation is not present in humans- shame but there is a mechanism to take care of this problem in humans

Excision repair- if a bit of DNA is damaged, it may be excised and replaced. So the dimer is cut out and replaced by non dimerized bases.

Another example if Uracil is incorporated into DNA by accident there is an enzyme that comes along snips it out and replaces it with thymine-

This kind of single base excision and repair is common. - nucleotide excision repair

Ch 16 continued

focus on Purdue: Joe Ogas

http://www.biochem.purdue.edu/~bmb/faculty/ogas.html

nucletide excision repair triggered by base mismatch is called mismatch repair

If DNA replication occurs in an area that has been damaged then the damaged piece may be "skipped" leaving a break of several hundred bases in the synthesis of the new strand. This gap is unstable and it's persistence would be bad. It can be repaired post replication in a process called post replicative repair. Area's needing post replicative repair trigger an SOS response. This response is triggered by a consensus sequence in the promoter called an SOS box.

RecA

this is an enzyme involved in gap repair. It has two major properties, it is involved in recombination and gap repair.

This leads us back to recombination. What do recombination and gap repair have in common that the same enzyme can function in both areas? Well both involve single stranded DNA and forming homologous pairing after a breakage.

read on your own about Holliday junctions and hybrid DNA

focus on Purdue Irwin Tessman

http://www.biochem.purdue.edu/~bmb/faculty/tess.html

Ch 17

This is called non-mendelian inheritance so what are we talking about? Influences of non-nuclear DNA- cytoplasmic effects also often called maternal effects as the initial zygotic cytoplasm is from the egg (mother) these are often called maternal effects,

Cytoplasmic inheritance is controlled by nonnuclear genomes- they are …

chlorolplasts

mitochondria

plasmids

infective agents

So what does this mean-- basically we need to think about this in its own way.

If we look at a trait and the inheritance depends not on what the phenotypes of both parents were but only on the phenotype of the mother, through several generations, then there is evidence of maternal cytoplasmic effect on gene expression.

Mitochondria- in mammals these live in the cytoplasm and the vast majority are inherited by the mother- there are sometimes a few mitochondrion that are inherited paternally. In mussels inheritance of mitochondrion is biparental. In some gymnosperm plants inheritance is almost completely paternal.

The human mitochondrial DNA has been completely sequenced. The D-loop is often used in cases of forensic identification when it is important to establish whether the body was a child of a particular mother. It is 16,569 bp long - has few non-coding regions and no introns. The mitochondrion uses products of its own genes and products of nuclear genes to make energy. Proteins that need to move into the mitochondrion have special signal sequences (Ch 11- zip codes).

Mitochondrion have their own rRNA. This rRNA is different from the nuclear rRNA. If we examine the rRNA from the nucleus, mitochondrion, and a prokaryote the mitochondrial rRNA is more similar to the pokaryotic rRNA than nuclear rRNA.

symbiotic theory- the mitochondrion were once separate organisms (like e. coli) over time they became organelles.

chloroplasts

like mitochondrion chloroplasts

Rubisco

In the process of photosynthesis, plants convert light into the chemical energy that is used to synthesize sugars and other food stuffs. The first and rate-limiting

step in photosynthesis involves the fixation of atmospheric CO2 by the enzyme Rubisco. The activity of Rubisco is regulated by another enzyme called

Rubisco activase. Rubisco activase controls the overall process of photosynthesis by making Rubisco activity responsive to light intensity. Rubisco activase

use a compound called ATP, the energy currency in all living cells, to obtain the energy for controlling Rubisco.

Current reasearch focuses on Rubisco:

A recent paper reviews the subject of Rubisco

activase and discusses a possible model for the mechanism of the enzyme. Information about the mechanism of Rubisco activase eventually can be used to

make changes that improve the activity of the enzyme. An improved Rubisco activase could be used to increase photosynthetic efficiency.

http://icdweb.cc.purdue.edu/~knollje/Rubisco.html

Rubisco has large and small subunits.

http://csm.jmu.edu/biology/courses/bio220/rubisco.html

The large subunits are coded in nuclear DNA and the small subunits are coded in the cholorplasts.

What else about Rubisco is cool?

http://stratsoy.ag.uiuc.edu/~stratsoy/research_96/il040984.html

Chloroplasts are also maternally inherited.

Can you think of any problems in modifying chloroplast genes?

There are many cholorplasts- not just one like the nucleus so changing or modifying

them is more difficult-

they can interact with nuclear genes and so they might need to have complementary changes in the nuclear genes they interact with

in the plant you have the problem of separating cholorplast effects from mitochondrion effects.

Plasmids

Drug resistance in bacteria are due to plasmids.

Are extranuclear pieces of DNA the only "strange" effect that can be seen in inheritance?

Is everything else mendelian?

NO

Imprinting- this is when inheritance of one set of genes from one parent is methylated

what does that methylation imply?

Blocked gene expression.

http://www.geneimprint.com/

extra reading on genomic imprinting and cancer - this is a pdf file and will be posted to the web.

Infection

In Drosophila there has been a demonstration of an infection that causes infected females to only produce female offspring.