The query sequence for this search has been filtered. Filtering
eliminates low complexity regions that commonly give spuriously high
scores that reflect compositional bias rather than significant
position-by-position alignment. Filtering can eliminate these potentially
confounding matches (e.g., hits against proline-rich regions or poly-A
tails) from the blast reports, leaving regions whose blast statistics
reflect the specificity of their pairwise alignment.
BLASTN 2.2.3 [Apr-24-2002]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Fgr-S3_1_A20_T7.seq Fgr-S3_1_A20_T7 LENGTH:169bp ;
DIRECTION:5 ; CLONE:Fgr-S3_1_A20 ; CLONELIB: n/a
(169 letters)
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
1,217,082 sequences; 1,205,879,881 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|AJ315794.1|HVU315794 Hordeum vulgare mRNA for Ribosomal... 113 6e-23
gb|AF118149.1|AF118149 Secale cereale ribosomal protein S7 ... 66 1e-08
emb|AL391148.1|ATT21H19 Arabidopsis thaliana DNA chromosome... 60 7e-07
ref|NM_121618.1| Arabidopsis thaliana chromosome 5 clone CH... 58 3e-06
emb|AJ293850.1|KPN293850 Klebsiella pneumoniae partial EVGA... 44 0.043
emb|AJ293849.1|KPN293849 Klebsiella pneumoniae contig regio... 44 0.043
emb|AJ293848.1|KPN293848 Klebsiella pneumoniae contig regio... 44 0.043
gb|AF271776.1|AF271776 Homo sapiens DC48 mRNA, complete cds 42 0.17
emb|AJ315149.1|OMY315149 Oncorhynchus mykiss mRNA for CC ch... 42 0.17
gb|AF151726.1|AF151726 Dianthus caryophyllus clone CFMI-6 42 0.17
emb|AJ293847.1|KPN293847 Klebsiella pneumoniae contig regio... 42 0.17
emb|AJ293846.1|KPN293846 Klebsiella pneumoniae transposon T... 42 0.17
emb|AJ276853.1|KPN276853 Klebsiella pneumoniae partial SL02... 42 0.17
emb|AJ276850.1|KPN276850 Klebsiella pneumoniae partial SL01... 42 0.17
emb|AJ250102.1|OCU250102 Oryctolagus cuniculus partial mRNA... 42 0.17
emb|AJ276856.1|KPN276856 Klebsiella pneumoniae partial SL03... 42 0.17
dbj|AB019571.1|AB019571 Homo sapiens mRNA expressed only in... 42 0.17
dbj|AB019563.1|AB019563 Homo sapiens mRNA expressed only in... 42 0.17
ref|NM_103777.1| Arabidopsis thaliana chromosome 1 clone CH... 40 0.67
gb|AY072617.1| Arabidopsis thaliana At1g48830/T24P22_5 mRNA... 40 0.67
gb|AF412048.1|AF412048 Arabidopsis thaliana At1g48830/T24P2... 40 0.67
gb|AC073555.9|AC073555 Arabidopsis thaliana chromosome I cl... 40 0.67
gb|AC084242.4|AC084242 Arabidopsis thaliana chromosome I cl... 40 0.67
dbj|AB019573.1|AB019573 Homo sapiens mRNA expressed only in... 40 0.67
gb|AC092393.2| Homo sapiens chromosome 1 clone RP4-736I12, ... 38 2.7
gb|AC069529.22| Homo sapiens 3 BAC RP11-332I3 (Roswell Park... 38 2.7
gb|AF139768.1|AF139768 Homo sapiens chromosome 7 map 7q33 38 2.7
gb|AF120321.1|AF120321 Mus musculus clone an01-h01 mRNA seq... 38 2.7
emb|AJ293853.1|KPN293853 Klebsiella pneumoniae partial YC04... 38 2.7
emb|AJ292929.1|ABI292929 Agaricus bisporus mRNA for CEL6 pr... 38 2.7
emb|AL136325.6|AL136325 Human DNA sequence from clone RP5-9... 38 2.7
dbj|AP003010.2|AP003010 Mesorhizobium loti DNA, complete ge... 38 2.7
dbj|AB019574.1|AB019574 Homo sapiens mRNA expressed only in... 38 2.7
dbj|AB019572.1|AB019572 Homo sapiens mRNA expressed only in... 38 2.7
dbj|AB019567.1|AB019567 Homo sapiens mRNA expressed only in... 38 2.7
dbj|AB019565.1|AB019565 Homo sapiens mRNA expressed only in... 38 2.7
dbj|AB019564.1|AB019564 Homo sapiens mRNA expressed only in... 38 2.7
dbj|AB019562.1|AB019562 Homo sapiens mRNA expressed only in... 38 2.7
>emb|AJ315794.1|HVU315794 Hordeum vulgare mRNA for Ribosomal protein S7 (rps7 gene)
Length = 852
Score = 113 bits (57), Expect = 6e-23
Identities = 60/61 (98%)
Strand = Plus / Minus
Query: 18 acagcagaacccttcttgggtggcctcacgatccttcttgttgcaacaaagacaacatcc 77
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 395 acagcagaacccttcttgggtggcctcacaatccttcttgttgcaacaaagacaacatcc 336
Query: 78 t 78
|
Sbjct: 335 t 335
>gb|AF118149.1|AF118149 Secale cereale ribosomal protein S7 mRNA, complete cds
Length = 819
Score = 65.9 bits (33), Expect = 1e-08
Identities = 45/49 (91%)
Strand = Plus / Minus
Query: 18 acagcagaacccttcttgggtggcctcacgatccttcttgttgcaacaa 66
||||||||||||||||||||||||||||| |||| ||||| |||||||
Sbjct: 367 acagcagaacccttcttgggtggcctcacaatccgccttgtagcaacaa 319
>emb|AL391148.1|ATT21H19 Arabidopsis thaliana DNA chromosome 5, BAC clone T21H19 (ESSA project)
Length = 77311
Score = 60.0 bits (30), Expect = 7e-07
Identities = 54/62 (87%)
Strand = Plus / Minus
Query: 18 acagcagaacccttcttgggtggcctcacgatccttcttgttgcaacaaagacaacatcc 77
||||||| |||||||||||| || | || |||||||||||| | |||||||| |||||||
Sbjct: 13601 acagcagcacccttcttggggggacgcatgatccttcttgtggtaacaaagataacatcc 13542
Query: 78 tg 79
||
Sbjct: 13541 tg 13540
>ref|NM_121618.1| Arabidopsis thaliana chromosome 5 clone CHR5v12152001
Length = 872
Score = 58.0 bits (29), Expect = 3e-06
Identities = 53/61 (86%)
Strand = Plus / Minus
Query: 18 acagcagaacccttcttgggtggcctcacgatccttcttgttgcaacaaagacaacatcc 77
||||||| |||||||||||| || | || |||||||||||| | |||||||| |||||||
Sbjct: 461 acagcagcacccttcttggggggacgcatgatccttcttgtggtaacaaagataacatcc 402
Query: 78 t 78
|
Sbjct: 401 t 401
>emb|AJ293850.1|KPN293850 Klebsiella pneumoniae partial EVGA gene for putative positive
transcription regulator EVGA, contig region pSL042
Length = 450
Score = 44.1 bits (22), Expect = 0.043
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 147 agtacctcggccgcgaccacgc 168
||||||||||||||||||||||
Sbjct: 78 agtacctcggccgcgaccacgc 57
>emb|AJ293849.1|KPN293849 Klebsiella pneumoniae contig region pSL029
Length = 720
Score = 44.1 bits (22), Expect = 0.043
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 147 agtacctcggccgcgaccacgc 168
||||||||||||||||||||||
Sbjct: 41 agtacctcggccgcgaccacgc 20
>emb|AJ293848.1|KPN293848 Klebsiella pneumoniae contig region pSL022
Length = 739
Score = 44.1 bits (22), Expect = 0.043
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 147 agtacctcggccgcgaccacgc 168
||||||||||||||||||||||
Sbjct: 53 agtacctcggccgcgaccacgc 32
>gb|AF271776.1|AF271776 Homo sapiens DC48 mRNA, complete cds
Length = 1033
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 844 gtacctcggccgcgaccacgc 864
>emb|AJ315149.1|OMY315149 Oncorhynchus mykiss mRNA for CC chemokine
Length = 548
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 527 gtacctcggccgcgaccacgc 547
>gb|AF151726.1|AF151726 Dianthus caryophyllus clone CFMI-6
Length = 553
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 509 gtacctcggccgcgaccacgc 529
>emb|AJ293847.1|KPN293847 Klebsiella pneumoniae contig region pSL015
Length = 700
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 401 gtacctcggccgcgaccacgc 421
>emb|AJ293846.1|KPN293846 Klebsiella pneumoniae transposon TN3926 partial tra7 gene for
transposase, contig region pSL007
Length = 748
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 682 gtacctcggccgcgaccacgc 702
>emb|AJ276853.1|KPN276853 Klebsiella pneumoniae partial SL021 plasmid
Length = 450
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 427 gtacctcggccgcgaccacgc 447
>emb|AJ276850.1|KPN276850 Klebsiella pneumoniae partial SL017 plasmid
Length = 450
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 282 gtacctcggccgcgaccacgc 302
>emb|AJ250102.1|OCU250102 Oryctolagus cuniculus partial mRNA for haptoglobin
Length = 647
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 23 gtacctcggccgcgaccacgc 3
>emb|AJ276856.1|KPN276856 Klebsiella pneumoniae partial SL038 plasmid
Length = 450
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 405 gtacctcggccgcgaccacgc 425
>dbj|AB019571.1|AB019571 Homo sapiens mRNA expressed only in placental villi, clone SMAP5
Length = 1042
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 22 gtacctcggccgcgaccacgc 2
>dbj|AB019563.1|AB019563 Homo sapiens mRNA expressed only in placental villi, clone SMAP42
Length = 333
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 148 gtacctcggccgcgaccacgc 168
|||||||||||||||||||||
Sbjct: 312 gtacctcggccgcgaccacgc 332
>ref|NM_103777.1| Arabidopsis thaliana chromosome 1 clone CHR1v12152001
Length = 842
Score = 40.1 bits (20), Expect = 0.67
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 24 gaacccttcttgggtggcctcacgatccttcttgttgcaa 63
||||||||||| || |||||||| ||||| ||||| ||||
Sbjct: 428 gaacccttctttggcggcctcacaatcctccttgtagcaa 389
>gb|AY072617.1| Arabidopsis thaliana At1g48830/T24P22_5 mRNA, complete cds
Length = 576
Score = 40.1 bits (20), Expect = 0.67
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 24 gaacccttcttgggtggcctcacgatccttcttgttgcaa 63
||||||||||| || |||||||| ||||| ||||| ||||
Sbjct: 326 gaacccttctttggcggcctcacaatcctccttgtagcaa 287
>gb|AF412048.1|AF412048 Arabidopsis thaliana At1g48830/T24P22_5 mRNA, complete cds
Length = 814
Score = 40.1 bits (20), Expect = 0.67
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 24 gaacccttcttgggtggcctcacgatccttcttgttgcaa 63
||||||||||| || |||||||| ||||| ||||| ||||
Sbjct: 423 gaacccttctttggcggcctcacaatcctccttgtagcaa 384
>gb|AC073555.9|AC073555 Arabidopsis thaliana chromosome I clone F11I4, complete sequence
Length = 80561
Score = 40.1 bits (20), Expect = 0.67
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 24 gaacccttcttgggtggcctcacgatccttcttgttgcaa 63
||||||||||| || |||||||| ||||| ||||| ||||
Sbjct: 1857 gaacccttctttggcggcctcacaatcctccttgtagcaa 1818
>gb|AC084242.4|AC084242 Arabidopsis thaliana chromosome I clone T24P22 map ?, complete sequence
Length = 18062
Score = 40.1 bits (20), Expect = 0.67
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 24 gaacccttcttgggtggcctcacgatccttcttgttgcaa 63
||||||||||| || |||||||| ||||| ||||| ||||
Sbjct: 15546 gaacccttctttggcggcctcacaatcctccttgtagcaa 15507
>dbj|AB019573.1|AB019573 Homo sapiens mRNA expressed only in placental villi, clone SMAP31
Length = 300
Score = 40.1 bits (20), Expect = 0.67
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 149 tacctcggccgcgaccacgc 168
||||||||||||||||||||
Sbjct: 21 tacctcggccgcgaccacgc 2
>gb|AC092393.2| Homo sapiens chromosome 1 clone RP4-736I12, complete sequence
Length = 90525
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 55 ttgttgcaacaaagacaac 73
|||||||||||||||||||
Sbjct: 77797 ttgttgcaacaaagacaac 77815
>gb|AC069529.22| Homo sapiens 3 BAC RP11-332I3 (Roswell Park Cancer Institute Human BAC
Library) complete sequence
Length = 173202
Score = 38.2 bits (19), Expect = 2.7
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 17 tacagcagaacccttcttgggtg 39
||||||||||||||| |||||||
Sbjct: 141204 tacagcagaaccctttttgggtg 141226
>gb|AF139768.1|AF139768 Homo sapiens chromosome 7 map 7q33
Length = 985
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 150 acctcggccgcgaccacgc 168
|||||||||||||||||||
Sbjct: 20 acctcggccgcgaccacgc 2
>gb|AF120321.1|AF120321 Mus musculus clone an01-h01 mRNA sequence
Length = 157
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 150 acctcggccgcgaccacgc 168
|||||||||||||||||||
Sbjct: 135 acctcggccgcgaccacgc 153
>emb|AJ293853.1|KPN293853 Klebsiella pneumoniae partial YC04 gene for putative capsule
polysaccharide export protein precursor, contig region
pSL001
Length = 500
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 150 acctcggccgcgaccacgc 168
|||||||||||||||||||
Sbjct: 39 acctcggccgcgaccacgc 21
>emb|AJ292929.1|ABI292929 Agaricus bisporus mRNA for CEL6 protein
Length = 2579
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 150 acctcggccgcgaccacgc 168
|||||||||||||||||||
Sbjct: 20 acctcggccgcgaccacgc 2
>emb|AL136325.6|AL136325 Human DNA sequence from clone RP5-983F16 on chromosome 1p21.3-22.2.
Contains an EEF1A1 (eukaryotic translation elongation
factor 1 alpha 1) pseudogene, ESTs, STSs, GSSs and a CpG
island, complete sequence [Homo sapiens]
Length = 133052
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 55 ttgttgcaacaaagacaac 73
|||||||||||||||||||
Sbjct: 37452 ttgttgcaacaaagacaac 37470
>dbj|AP003010.2|AP003010 Mesorhizobium loti DNA, complete genome, section 17/21
Length = 340857
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 44 cacgatccttcttgttgca 62
|||||||||||||||||||
Sbjct: 160002 cacgatccttcttgttgca 160020
>dbj|AB019574.1|AB019574 Homo sapiens mRNA expressed only in placental villi, clone SMAP27
Length = 106
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 150 acctcggccgcgaccacgc 168
|||||||||||||||||||
Sbjct: 20 acctcggccgcgaccacgc 2
>dbj|AB019572.1|AB019572 Homo sapiens mRNA expressed only in placental villi, clone SMAP26
Length = 190
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 150 acctcggccgcgaccacgc 168
|||||||||||||||||||
Sbjct: 20 acctcggccgcgaccacgc 2
>dbj|AB019567.1|AB019567 Homo sapiens mRNA expressed only in placental villi, clone SMAP77
Length = 171
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 150 acctcggccgcgaccacgc 168
|||||||||||||||||||
Sbjct: 20 acctcggccgcgaccacgc 2
>dbj|AB019565.1|AB019565 Homo sapiens mRNA expressed only in placental villi, clone SMAP52
Length = 1044
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 150 acctcggccgcgaccacgc 168
|||||||||||||||||||
Sbjct: 20 acctcggccgcgaccacgc 2
>dbj|AB019564.1|AB019564 Homo sapiens mRNA expressed only in placental villi, clone SMAP47
Length = 417
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 150 acctcggccgcgaccacgc 168
|||||||||||||||||||
Sbjct: 37 acctcggccgcgaccacgc 55
>dbj|AB019562.1|AB019562 Homo sapiens mRNA expressed only in placental villi, clone SMAP41
Length = 103
Score = 38.2 bits (19), Expect = 2.7
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 150 acctcggccgcgaccacgc 168
|||||||||||||||||||
Sbjct: 84 acctcggccgcgaccacgc 102
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
Posted date: May 13, 2002 3:54 AM
Number of letters in database: 1,205,879,881
Number of sequences in database: 1,217,082
Lambda K H
1.37 0.711 0.00
Gapped
Lambda K H
1.37 0.711 4.94e-324
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 428,092
Number of Sequences: 1217082
Number of extensions: 428092
Number of successful extensions: 25627
Number of sequences better than 10.0: 38
length of query: 169
length of database: 5,500,847,177
effective HSP length: 20
effective length of query: 149
effective length of database: 5,476,505,537
effective search space: 815999325013
effective search space used: 815999325013
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)