The query sequence for this search has been filtered. Filtering
eliminates low complexity regions that commonly give spuriously high
scores that reflect compositional bias rather than significant
position-by-position alignment. Filtering can eliminate these potentially
confounding matches (e.g., hits against proline-rich regions or poly-A
tails) from the blast reports, leaving regions whose blast statistics
reflect the specificity of their pairwise alignment.

BLASTN 2.2.3 [Apr-24-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Fgr-S3_1_A20_T7.seq Fgr-S3_1_A20_T7 LENGTH:169bp ;
DIRECTION:5 ; CLONE:Fgr-S3_1_A20 ; CLONELIB: n/a 
         (169 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
           1,217,082 sequences; 1,205,879,881 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|AJ315794.1|HVU315794  Hordeum vulgare mRNA for Ribosomal...   113   6e-23
gb|AF118149.1|AF118149  Secale cereale ribosomal protein S7 ...    66   1e-08
emb|AL391148.1|ATT21H19  Arabidopsis thaliana DNA chromosome...    60   7e-07
ref|NM_121618.1|  Arabidopsis thaliana chromosome 5 clone CH...    58   3e-06
emb|AJ293850.1|KPN293850  Klebsiella pneumoniae partial EVGA...    44   0.043
emb|AJ293849.1|KPN293849  Klebsiella pneumoniae contig regio...    44   0.043
emb|AJ293848.1|KPN293848  Klebsiella pneumoniae contig regio...    44   0.043
gb|AF271776.1|AF271776  Homo sapiens DC48 mRNA, complete cds       42   0.17 
emb|AJ315149.1|OMY315149  Oncorhynchus mykiss mRNA for CC ch...    42   0.17 
gb|AF151726.1|AF151726  Dianthus caryophyllus clone CFMI-6         42   0.17 
emb|AJ293847.1|KPN293847  Klebsiella pneumoniae contig regio...    42   0.17 
emb|AJ293846.1|KPN293846  Klebsiella pneumoniae transposon T...    42   0.17 
emb|AJ276853.1|KPN276853  Klebsiella pneumoniae partial SL02...    42   0.17 
emb|AJ276850.1|KPN276850  Klebsiella pneumoniae partial SL01...    42   0.17 
emb|AJ250102.1|OCU250102  Oryctolagus cuniculus partial mRNA...    42   0.17 
emb|AJ276856.1|KPN276856  Klebsiella pneumoniae partial SL03...    42   0.17 
dbj|AB019571.1|AB019571  Homo sapiens mRNA expressed only in...    42   0.17 
dbj|AB019563.1|AB019563  Homo sapiens mRNA expressed only in...    42   0.17 
ref|NM_103777.1|  Arabidopsis thaliana chromosome 1 clone CH...    40   0.67 
gb|AY072617.1|  Arabidopsis thaliana At1g48830/T24P22_5 mRNA...    40   0.67 
gb|AF412048.1|AF412048  Arabidopsis thaliana At1g48830/T24P2...    40   0.67 
gb|AC073555.9|AC073555  Arabidopsis thaliana chromosome I cl...    40   0.67 
gb|AC084242.4|AC084242  Arabidopsis thaliana chromosome I cl...    40   0.67 
dbj|AB019573.1|AB019573  Homo sapiens mRNA expressed only in...    40   0.67 
gb|AC092393.2|  Homo sapiens chromosome 1 clone RP4-736I12, ...    38   2.7  
gb|AC069529.22|  Homo sapiens 3 BAC RP11-332I3 (Roswell Park...    38   2.7  
gb|AF139768.1|AF139768  Homo sapiens chromosome 7 map 7q33         38   2.7  
gb|AF120321.1|AF120321  Mus musculus clone an01-h01 mRNA seq...    38   2.7  
emb|AJ293853.1|KPN293853  Klebsiella pneumoniae partial YC04...    38   2.7  
emb|AJ292929.1|ABI292929  Agaricus bisporus mRNA for CEL6 pr...    38   2.7  
emb|AL136325.6|AL136325  Human DNA sequence from clone RP5-9...    38   2.7  
dbj|AP003010.2|AP003010  Mesorhizobium loti DNA, complete ge...    38   2.7  
dbj|AB019574.1|AB019574  Homo sapiens mRNA expressed only in...    38   2.7  
dbj|AB019572.1|AB019572  Homo sapiens mRNA expressed only in...    38   2.7  
dbj|AB019567.1|AB019567  Homo sapiens mRNA expressed only in...    38   2.7  
dbj|AB019565.1|AB019565  Homo sapiens mRNA expressed only in...    38   2.7  
dbj|AB019564.1|AB019564  Homo sapiens mRNA expressed only in...    38   2.7  
dbj|AB019562.1|AB019562  Homo sapiens mRNA expressed only in...    38   2.7  
>emb|AJ315794.1|HVU315794 Hordeum vulgare mRNA for Ribosomal protein S7 (rps7 gene)
          Length = 852

 Score =  113 bits (57), Expect = 6e-23
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                       
Query: 18  acagcagaacccttcttgggtggcctcacgatccttcttgttgcaacaaagacaacatcc 77
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 395 acagcagaacccttcttgggtggcctcacaatccttcttgttgcaacaaagacaacatcc 336

            
Query: 78  t 78
           |
Sbjct: 335 t 335
>gb|AF118149.1|AF118149 Secale cereale ribosomal protein S7 mRNA, complete cds
          Length = 819

 Score = 65.9 bits (33), Expect = 1e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 18  acagcagaacccttcttgggtggcctcacgatccttcttgttgcaacaa 66
           ||||||||||||||||||||||||||||| ||||  ||||| |||||||
Sbjct: 367 acagcagaacccttcttgggtggcctcacaatccgccttgtagcaacaa 319
>emb|AL391148.1|ATT21H19 Arabidopsis thaliana DNA chromosome 5, BAC clone T21H19 (ESSA project)
          Length = 77311

 Score = 60.0 bits (30), Expect = 7e-07
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                         
Query: 18    acagcagaacccttcttgggtggcctcacgatccttcttgttgcaacaaagacaacatcc 77
             ||||||| |||||||||||| || | || |||||||||||| | |||||||| |||||||
Sbjct: 13601 acagcagcacccttcttggggggacgcatgatccttcttgtggtaacaaagataacatcc 13542

               
Query: 78    tg 79
             ||
Sbjct: 13541 tg 13540
>ref|NM_121618.1| Arabidopsis thaliana chromosome 5 clone CHR5v12152001
          Length = 872

 Score = 58.0 bits (29), Expect = 3e-06
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 18  acagcagaacccttcttgggtggcctcacgatccttcttgttgcaacaaagacaacatcc 77
           ||||||| |||||||||||| || | || |||||||||||| | |||||||| |||||||
Sbjct: 461 acagcagcacccttcttggggggacgcatgatccttcttgtggtaacaaagataacatcc 402

            
Query: 78  t 78
           |
Sbjct: 401 t 401
>emb|AJ293850.1|KPN293850 Klebsiella pneumoniae partial EVGA gene for putative positive
           transcription regulator EVGA, contig region pSL042
          Length = 450

 Score = 44.1 bits (22), Expect = 0.043
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 147 agtacctcggccgcgaccacgc 168
           ||||||||||||||||||||||
Sbjct: 78  agtacctcggccgcgaccacgc 57
>emb|AJ293849.1|KPN293849 Klebsiella pneumoniae contig region pSL029
          Length = 720

 Score = 44.1 bits (22), Expect = 0.043
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 147 agtacctcggccgcgaccacgc 168
           ||||||||||||||||||||||
Sbjct: 41  agtacctcggccgcgaccacgc 20
>emb|AJ293848.1|KPN293848 Klebsiella pneumoniae contig region pSL022
          Length = 739

 Score = 44.1 bits (22), Expect = 0.043
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 147 agtacctcggccgcgaccacgc 168
           ||||||||||||||||||||||
Sbjct: 53  agtacctcggccgcgaccacgc 32
>gb|AF271776.1|AF271776 Homo sapiens DC48 mRNA, complete cds
          Length = 1033

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 844 gtacctcggccgcgaccacgc 864
>emb|AJ315149.1|OMY315149 Oncorhynchus mykiss mRNA for CC chemokine
          Length = 548

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 527 gtacctcggccgcgaccacgc 547
>gb|AF151726.1|AF151726 Dianthus caryophyllus clone CFMI-6
          Length = 553

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 509 gtacctcggccgcgaccacgc 529
>emb|AJ293847.1|KPN293847 Klebsiella pneumoniae contig region pSL015
          Length = 700

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 401 gtacctcggccgcgaccacgc 421
>emb|AJ293846.1|KPN293846 Klebsiella pneumoniae transposon TN3926 partial tra7 gene for
           transposase, contig region pSL007
          Length = 748

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 682 gtacctcggccgcgaccacgc 702
>emb|AJ276853.1|KPN276853 Klebsiella pneumoniae partial SL021 plasmid
          Length = 450

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 427 gtacctcggccgcgaccacgc 447
>emb|AJ276850.1|KPN276850 Klebsiella pneumoniae partial SL017 plasmid
          Length = 450

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 282 gtacctcggccgcgaccacgc 302
>emb|AJ250102.1|OCU250102 Oryctolagus cuniculus partial mRNA for haptoglobin
          Length = 647

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 23  gtacctcggccgcgaccacgc 3
>emb|AJ276856.1|KPN276856 Klebsiella pneumoniae partial SL038 plasmid
          Length = 450

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 405 gtacctcggccgcgaccacgc 425
>dbj|AB019571.1|AB019571 Homo sapiens mRNA expressed only in placental villi, clone SMAP5
          Length = 1042

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 22  gtacctcggccgcgaccacgc 2
>dbj|AB019563.1|AB019563 Homo sapiens mRNA expressed only in placental villi, clone SMAP42
          Length = 333

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 148 gtacctcggccgcgaccacgc 168
           |||||||||||||||||||||
Sbjct: 312 gtacctcggccgcgaccacgc 332
>ref|NM_103777.1| Arabidopsis thaliana chromosome 1 clone CHR1v12152001
          Length = 842

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 24  gaacccttcttgggtggcctcacgatccttcttgttgcaa 63
           ||||||||||| || |||||||| ||||| ||||| ||||
Sbjct: 428 gaacccttctttggcggcctcacaatcctccttgtagcaa 389
>gb|AY072617.1| Arabidopsis thaliana At1g48830/T24P22_5 mRNA, complete cds
          Length = 576

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 24  gaacccttcttgggtggcctcacgatccttcttgttgcaa 63
           ||||||||||| || |||||||| ||||| ||||| ||||
Sbjct: 326 gaacccttctttggcggcctcacaatcctccttgtagcaa 287
>gb|AF412048.1|AF412048 Arabidopsis thaliana At1g48830/T24P22_5 mRNA, complete cds
          Length = 814

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 24  gaacccttcttgggtggcctcacgatccttcttgttgcaa 63
           ||||||||||| || |||||||| ||||| ||||| ||||
Sbjct: 423 gaacccttctttggcggcctcacaatcctccttgtagcaa 384
>gb|AC073555.9|AC073555 Arabidopsis thaliana chromosome I clone F11I4, complete sequence
          Length = 80561

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 24   gaacccttcttgggtggcctcacgatccttcttgttgcaa 63
            ||||||||||| || |||||||| ||||| ||||| ||||
Sbjct: 1857 gaacccttctttggcggcctcacaatcctccttgtagcaa 1818
>gb|AC084242.4|AC084242 Arabidopsis thaliana chromosome I clone T24P22 map ?, complete sequence
          Length = 18062

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                     
Query: 24    gaacccttcttgggtggcctcacgatccttcttgttgcaa 63
             ||||||||||| || |||||||| ||||| ||||| ||||
Sbjct: 15546 gaacccttctttggcggcctcacaatcctccttgtagcaa 15507
>dbj|AB019573.1|AB019573 Homo sapiens mRNA expressed only in placental villi, clone SMAP31
          Length = 300

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 149 tacctcggccgcgaccacgc 168
           ||||||||||||||||||||
Sbjct: 21  tacctcggccgcgaccacgc 2
>gb|AC092393.2| Homo sapiens chromosome 1 clone RP4-736I12, complete sequence
          Length = 90525

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    ttgttgcaacaaagacaac 73
             |||||||||||||||||||
Sbjct: 77797 ttgttgcaacaaagacaac 77815
>gb|AC069529.22| Homo sapiens 3 BAC RP11-332I3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 173202

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 17     tacagcagaacccttcttgggtg 39
              ||||||||||||||| |||||||
Sbjct: 141204 tacagcagaaccctttttgggtg 141226
>gb|AF139768.1|AF139768 Homo sapiens chromosome 7 map 7q33
          Length = 985

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 150 acctcggccgcgaccacgc 168
           |||||||||||||||||||
Sbjct: 20  acctcggccgcgaccacgc 2
>gb|AF120321.1|AF120321 Mus musculus clone an01-h01 mRNA sequence
          Length = 157

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 150 acctcggccgcgaccacgc 168
           |||||||||||||||||||
Sbjct: 135 acctcggccgcgaccacgc 153
>emb|AJ293853.1|KPN293853 Klebsiella pneumoniae partial YC04 gene for putative capsule
           polysaccharide export protein precursor, contig region
           pSL001
          Length = 500

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 150 acctcggccgcgaccacgc 168
           |||||||||||||||||||
Sbjct: 39  acctcggccgcgaccacgc 21
>emb|AJ292929.1|ABI292929 Agaricus bisporus mRNA for CEL6 protein
          Length = 2579

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 150 acctcggccgcgaccacgc 168
           |||||||||||||||||||
Sbjct: 20  acctcggccgcgaccacgc 2
>emb|AL136325.6|AL136325 Human DNA sequence from clone RP5-983F16 on chromosome 1p21.3-22.2.
             Contains an EEF1A1 (eukaryotic translation elongation
             factor 1 alpha 1) pseudogene, ESTs, STSs, GSSs and a CpG
             island, complete sequence [Homo sapiens]
          Length = 133052

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    ttgttgcaacaaagacaac 73
             |||||||||||||||||||
Sbjct: 37452 ttgttgcaacaaagacaac 37470
>dbj|AP003010.2|AP003010 Mesorhizobium loti DNA, complete genome, section 17/21
          Length = 340857

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 44     cacgatccttcttgttgca 62
              |||||||||||||||||||
Sbjct: 160002 cacgatccttcttgttgca 160020
>dbj|AB019574.1|AB019574 Homo sapiens mRNA expressed only in placental villi, clone SMAP27
          Length = 106

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 150 acctcggccgcgaccacgc 168
           |||||||||||||||||||
Sbjct: 20  acctcggccgcgaccacgc 2
>dbj|AB019572.1|AB019572 Homo sapiens mRNA expressed only in placental villi, clone SMAP26
          Length = 190

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 150 acctcggccgcgaccacgc 168
           |||||||||||||||||||
Sbjct: 20  acctcggccgcgaccacgc 2
>dbj|AB019567.1|AB019567 Homo sapiens mRNA expressed only in placental villi, clone SMAP77
          Length = 171

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 150 acctcggccgcgaccacgc 168
           |||||||||||||||||||
Sbjct: 20  acctcggccgcgaccacgc 2
>dbj|AB019565.1|AB019565 Homo sapiens mRNA expressed only in placental villi, clone SMAP52
          Length = 1044

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 150 acctcggccgcgaccacgc 168
           |||||||||||||||||||
Sbjct: 20  acctcggccgcgaccacgc 2
>dbj|AB019564.1|AB019564 Homo sapiens mRNA expressed only in placental villi, clone SMAP47
          Length = 417

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 150 acctcggccgcgaccacgc 168
           |||||||||||||||||||
Sbjct: 37  acctcggccgcgaccacgc 55
>dbj|AB019562.1|AB019562 Homo sapiens mRNA expressed only in placental villi, clone SMAP41
          Length = 103

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 150 acctcggccgcgaccacgc 168
           |||||||||||||||||||
Sbjct: 84  acctcggccgcgaccacgc 102
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) Posted date: May 13, 2002 3:54 AM Number of letters in database: 1,205,879,881 Number of sequences in database: 1,217,082 Lambda K H 1.37 0.711 0.00 Gapped Lambda K H 1.37 0.711 4.94e-324 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 428,092 Number of Sequences: 1217082 Number of extensions: 428092 Number of successful extensions: 25627 Number of sequences better than 10.0: 38 length of query: 169 length of database: 5,500,847,177 effective HSP length: 20 effective length of query: 149 effective length of database: 5,476,505,537 effective search space: 815999325013 effective search space used: 815999325013 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)