The query sequence for this search has been filtered. Filtering
eliminates low complexity regions that commonly give spuriously high
scores that reflect compositional bias rather than significant
position-by-position alignment. Filtering can eliminate these potentially
confounding matches (e.g., hits against proline-rich regions or poly-A
tails) from the blast reports, leaving regions whose blast statistics
reflect the specificity of their pairwise alignment.

BLASTN 2.2.3 [Apr-24-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Fgr-S3_1_B08_T7.seq Fgr-S3_1_B08_T7 LENGTH:507bp ;
DIRECTION:5 ; CLONE:Fgr-S3_1_B08 ; CLONELIB: n/a 
         (507 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
           1,217,082 sequences; 1,205,879,881 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

dbj|AB042240.3|  Triticum aestivum chloroplast DNA, complete...    60   2e-06
gb|AF326781.1|AF326781  Triticum monococcum actin (ACT-1) ge...    52   6e-04
gb|AF133492.1|AF133492  Humbertochloa greenwayi ribosomal pr...    52   6e-04
gb|AF133487.1|AF133487  Puelia olyriformis ribosomal protein...    52   6e-04
gb|AF133485.1|AF133485  Arundo donax ribosomal protein 16 la...    52   6e-04
gb|AF133483.1|AF133483  Zeugites pittieri ribosomal protein ...    52   6e-04
gb|AF133473.1|AF133473  Otatea acuminata ribosomal protein 1...    52   6e-04
gb|AF133472.1|AF133472  Chusquea ramosissima ribosomal prote...    52   6e-04
gb|AF133471.1|AF133471  Glaziophyton mirabile ribosomal prot...    52   6e-04
gb|AF133470.1|AF133470  Bambusa longispiculata ribosomal pro...    52   6e-04
gb|AF133469.1|AF133469  Nastus elatus ribosomal protein 16 l...    52   6e-04
gb|AF133468.1|AF133468  Schizostachyum luzonicum ribosomal p...    52   6e-04
gb|AF133467.1|AF133467  Phyllostachys pubescens ribosomal pr...    52   6e-04
gb|AF133466.1|AF133466  Pseudosasa japonica ribosomal protei...    52   6e-04
gb|AF133465.1|AF133465  Arundinaria gigantea ribosomal prote...    52   6e-04
gb|U62793.1|NAU62793  Neurolepis aperta ribosomal protein L1...    52   6e-04
gb|U62792.1|CNU62792  Chusquea nudiramea ribosomal protein L...    52   6e-04
gb|U62791.1|CJU62791  Chusquea juergensii ribosomal protein ...    52   6e-04
gb|U62790.1|CVU62790  Chusquea vulcanalis ribosomal protein ...    52   6e-04
gb|U62789.1|CTU62789  Chusquea talamancensis ribosomal prote...    52   6e-04
gb|U62788.1|CSU62788  Chusquea spencei ribosomal protein L16...    52   6e-04
gb|U62787.1|CSU62787  Chusquea sp. A ribosomal protein L16 (...    52   6e-04
gb|U62786.1|COU62786  Chusquea oxylepis ribosomal protein L1...    52   6e-04
gb|U62785.1|COU62785  Chusquea oligophylla ribosomal protein...    52   6e-04
gb|U62784.1|CEU62784  Chusquea exasperata ribosomal protein ...    52   6e-04
gb|U62783.1|CSU62783  Chusquea sp. B ribosomal protein L16 (...    52   6e-04
gb|U62782.1|CTU62782  Chusquea tomentosa ribosomal protein L...    52   6e-04
gb|U62781.1|CSU62781  Chusquea scandens ribosomal protein L1...    52   6e-04
gb|U62780.1|CAU62780  Chusquea aff. fendleri ribosomal prote...    52   6e-04
gb|U54747.1|SLU54747  Schizostachyum luzonicum ribosomal pro...    52   6e-04
gb|U54744.1|PPU54744  Phyllostachys pubescens ribosomal prot...    52   6e-04
gb|U54743.1|PJU54743  Pseudosasa japonica ribosomal protein ...    52   6e-04
gb|U54749.1|OAU54749  Otatea acuminata ribosomal protein L16...    52   6e-04
gb|U54746.1|NEU54746  Nastus elatus ribosomal protein L16 (r...    52   6e-04
gb|U54748.1|GMU54748  Glaziophyton mirabile ribosomal protei...    52   6e-04
gb|U54755.1|CWU54755  Chusquea windischii ribosomal protein ...    52   6e-04
gb|U54752.1|CTU54752  Chusquea tessellata ribosomal protein ...    52   6e-04
gb|U54758.1|CSU54758  Chusquea sp. 'LC et al. 1309' ribosoma...    52   6e-04
gb|U54754.1|CSU54754  Chusquea serpens ribosomal protein L16...    52   6e-04
gb|U54753.1|CSU54753  Chusquea subtessellata ribosomal prote...    52   6e-04
gb|U54751.1|CRU54751  Chusquea ramosissima ribosomal protein...    52   6e-04
gb|U54756.1|CPU54756  Chusquea pinifolia ribosomal protein L...    52   6e-04
gb|U54760.1|CLU54760  Chusquea liebmannii ribosomal protein ...    52   6e-04
gb|U54759.1|CCU54759  Chusquea coronalis ribosomal protein L...    52   6e-04
gb|U54757.1|CBU54757  Chusquea bilimekii ribosomal protein L...    52   6e-04
gb|U54745.1|BLU54745  Bambusa longispiculata ribosomal prote...    52   6e-04
gb|U54742.1|AGU54742  Arundinaria gigantea ribosomal protein...    52   6e-04
gb|AF133477.1|AF133477  Zea mays ribosomal protein 16 large ...    48   0.009
emb|X86563.2|ZMA86563  Zea mays complete chloroplast genome        48   0.009
gb|M15176.1|MZECPPG  Zea mays chloroplast Eco x DNA                48   0.009
gb|AF133461.1|AF133461  Buergersiochloa bambusoides ribosoma...    46   0.036
gb|AF133458.1|AF133458  Leersia virginica ribosomal protein ...    46   0.036
gb|AF083221.1|AF083221  Takifugu rubripes                          46   0.036
gb|AF095730.1|AF095730  Glycine max retroelement diaspora ga...    46   0.036
emb|AJ293846.1|KPN293846  Klebsiella pneumoniae transposon T...    46   0.036
emb|AJ276853.1|KPN276853  Klebsiella pneumoniae partial SL02...    46   0.036
dbj|AB019563.1|AB019563  Homo sapiens mRNA expressed only in...    46   0.036
gb|AF133491.1|AF133491  Joinvillea ascendens ribosomal prote...    44   0.14 
gb|AF133490.1|AF133490  Streptochaeta angustifolia ribosomal...    44   0.14 
gb|AF133488.1|AF133488  Pharus lappulaceus ribosomal protein...    44   0.14 
gb|AF133486.1|AF133486  Molinia caerulea ribosomal protein 1...    44   0.14 
gb|AF133484.1|AF133484  Phragmites australis ribosomal prote...    44   0.14 
gb|AF133482.1|AF133482  Chasmanthium laxum ribosomal protein...    44   0.14 
gb|AF133480.1|AF133480  Zoysia matrella ribosomal protein 16...    44   0.14 
gb|AF133474.1|AF133474  Poa pratensis ribosomal protein 16 l...    44   0.14 
gb|AF133464.1|AF133464  Lithachne pauciflora ribosomal prote...    44   0.14 
gb|AF133460.1|AF133460  Streptogyna americana ribosomal prot...    44   0.14 
emb|AJ315149.1|OMY315149  Oncorhynchus mykiss mRNA for CC ch...    44   0.14 
emb|AJ279850.1|MMU279850  Mus musculus partial mRNA for hypo...    44   0.14 
emb|AJ293847.1|KPN293847  Klebsiella pneumoniae contig regio...    44   0.14 
emb|AJ276850.1|KPN276850  Klebsiella pneumoniae partial SL01...    44   0.14 
gb|U26024.1|BTU26024  Bos taurus pigpen mRNA, complete cds         44   0.14 
gb|U54750.1|RPU54750  Rhipidocladum pittieri ribosomal prote...    44   0.14 
gb|AF271776.1|AF271776  Homo sapiens DC48 mRNA, complete cds       42   0.56 
gb|AF133478.1|AF133478  Sorghum bicolor ribosomal protein 16...    42   0.56 
gb|AF133475.1|AF133475  Avena sativa ribosomal protein 16 la...    42   0.56 
gb|AF151726.1|AF151726  Dianthus caryophyllus clone CFMI-6         42   0.56 
emb|AJ310908.1|FVE310908  Fucus vesiculosus mRNA for ALA deh...    42   0.56 
emb|AJ293850.1|KPN293850  Klebsiella pneumoniae partial EVGA...    42   0.56 
emb|AJ293849.1|KPN293849  Klebsiella pneumoniae contig regio...    42   0.56 
emb|AJ293848.1|KPN293848  Klebsiella pneumoniae contig regio...    42   0.56 
emb|AJ276849.1|KPN276849  Klebsiella pneumoniae partial SL01...    42   0.56 
emb|AJ250102.1|OCU250102  Oryctolagus cuniculus partial mRNA...    42   0.56 
emb|AJ276856.1|KPN276856  Klebsiella pneumoniae partial SL03...    42   0.56 
dbj|AP003595.1|AP003595  Nostoc sp. PCC 7120 DNA, complete g...    42   0.56 
emb|AJ001134.1|SRMETPANS  Strongyloides ratti mRNA for metal...    42   0.56 
dbj|AB047592.1|AB047592  Trichophyton mentagrophytes mRNA fo...    42   0.56 
dbj|AB019571.1|AB019571  Homo sapiens mRNA expressed only in...    42   0.56 
ref|NM_139017.1|  Homo sapiens similar to CRL3 protein (CRL3...    40   2.2  
gb|AF097021.1|  Homo sapiens                                       40   2.2  
ref|NM_130806.2|  Homo sapiens similar to G protein coupled ...    40   2.2  
gb|AF022770.2|  Mus musculus strain BALB/c                         40   2.2  
ref|NM_007227.2|  Homo sapiens G protein-coupled receptor 45...    40   2.2  
gb|AC009957.11|  Homo sapiens BAC clone RP11-285H23 from 2, ...    40   2.2  
gb|AF403384.2|  Homo sapiens chromosome 11 map 11q13               40   2.2  
gb|AF075584.1|TGFA2  Homo sapiens transforming growth factor...    40   2.2  
gb|AF075583.1|TGFA1  Homo sapiens transforming growth factor...    40   2.2  
gb|AF106913.1|AF106913  Homo sapiens CRL3 protein (CRL3) mRN...    40   2.2  
gb|AF039086.1|AF039086  Pseudomicrothorax dubius articulin 1...    40   2.2  
gb|AF107491.1|AF107491  Hexamita sp.                               40   2.2  
gb|AF050198.1|AF050198  Homo sapiens                               40   2.2  
gb|AF139835.1|AF139835  Populus tremula x Populus tremuloides      40   2.2  
gb|AF042168.1|AF042168  Onchocerca volvulus                        40   2.2  
gb|AF074706.1|AF074706  Bos taurus                                 40   2.2  
emb|AJ318062.1|CNE318062  Cryptococcus neoformans mRNA for A...    40   2.2  
emb|AJ130894.1|HSA130894  Homo sapiens mRNA for transcriptio...    40   2.2  
emb|AJ306902.1|RCO306902  Ricinus communis mRNA for iron tra...    40   2.2  
gb|AF072534.1|AF072534  Capsicum annuum                            40   2.2  
emb|AJ133126.1|RNO33126  Rattus norvegicus mRNA for kelch-li...    40   2.2  
gb|AF133476.1|AF133476  Brachyelytrum erectum ribosomal prot...    40   2.2  
gb|AF133463.1|AF133463  Sucrea maculata ribosomal protein 16...    40   2.2  
gb|AF133675.1|AF133675  Populus tremula x Populus tremuloides      40   2.2  
emb|AJ416426.1|MMU416426  Mus musculus mRNA for damaged-DNA ...    40   2.2  
gb|AF117260.1|AF117260  Ceratopteris richardii ribosomal pro...    40   2.2  
gb|AF026274.1|AF026274  Mus musculus                               40   2.2  
gb|AF128458.1|AF128458  Homo sapiens                               40   2.2  
gb|L77146.1|ZEFHSC7R  Danio rerio heat shock cognate (hsc70)...    40   2.2  
gb|AF012324.1|AF012324  Mus musculus                               40   2.2  
gb|AF169248.2|AF169248  Opsanus beta                               40   2.2  
gb|AF002248.2|AF002248  Pisum sativum                              40   2.2  
emb|AJ292755.1|AGA292755  Anopheles gambiae mRNA for integri...    40   2.2  
gb|AF106660.1|AF106660  Lycopersicon esculentum                    40   2.2  
emb|AJ290944.2|MMU290944  Mus musculus mRNA for a stretch re...    40   2.2  
emb|AJ291825.1|LPE291825  Lolium perenne mRNA for oxalate ox...    40   2.2  
gb|AF127772.1|AF127772  Homo sapiens cell-line E8CASS clone ...    40   2.2  
gb|AF133731.2|AF133731  Rattus norvegicus strain Copenhagen        40   2.2  
gb|AF112153.1|AF112153  Rattus norvegicus                          40   2.2  
emb|AJ279852.1|MMU279852  Mus musculus partial mRNA for hypo...    40   2.2  
emb|AJ279849.1|MMU279849  Mus musculus partial mRNA for hypo...    40   2.2  
emb|AJ279847.1|MMU279847  Mus musculus partial mRNA for hypo...    40   2.2  
emb|AJ279846.1|MMU279846  Mus musculus partial mRNA for hypo...    40   2.2  
emb|AJ279839.1|MMU279839  Mus musculus partial mRNA for hypo...    40   2.2  
gb|U81599.1|HSU81599  Homo sapiens chromosome 17 map 17q21.2       40   2.2  
gb|AF125392.1|AF125392  Homo sapiens                               40   2.2  
gb|AF118559.1|AF118559  Avena fatua strain AN265                   40   2.2  
gb|AF098517.1|AF098517  Penicillium citrinum strain 52-5           40   2.2  
gb|AF095771.1|AF095771  Homo sapiens                               40   2.2  
emb|AJ006225.1|MCR6225  Mesembryanthemum crystallinum mRNA f...    40   2.2  
gb|AF061027.1|AF061027  Vernicia fordii                            40   2.2  
gb|U58918.1|ATU58918  Arabidopsis thaliana MEK kinase (MAP3K...    40   2.2  
gb|U55215.1|CPU55215  Cavia porcellus interleukin-5 receptor...    40   2.2  
gb|AF033850.1|AF033850  Homo sapiens                               40   2.2  
emb|AL445423.13|AL445423  Human DNA sequence from clone RP11...    40   2.2  
gb|AF067650.1|AF067650  Rattus norvegicus strain Sprague-Dawley    40   2.2  
gb|AF039201.1|  Pinus caribaea                                     40   2.2  
gb|AF053405.1|AF053405  Mus musculus                               40   2.2  
emb|AJ300524.2|PEU300524  Populus euramericana mRNA for puta...    40   2.2  
gb|AF074720.1|AF074720  Dicentrarchus labrax                       40   2.2  
emb|AJ272202.1|ATH272202  Arabidopsis thaliana mRNA for mito...    40   2.2  
gb|AF061514.1|AF061514  Gossypium hirsutum                         40   2.2  
emb|AJ293762.1|ABI293762  Snythetic construct chimeric mRNA ...    40   2.2  
gb|AF093414.1|AF093414  Saguinus oedipus                           40   2.2  
gb|AF064741.1|AF064741  Sus scrofa                                 40   2.2  
gb|AF084928.1|AF084928  Homo sapiens erythroblast macrophage...    40   2.2  
gb|AF061266.1|AF061266  Rattus norvegicus strain Sprague-Dawley    40   2.2  
gb|AF093139.1|AF093139  Rattus norvegicus strain Sprague Dawley    40   2.2  
gb|U77330.1|MMU77330  Mus musculus extracellular matrix prot...    40   2.2  
gb|U29343.1|HSU29343  Homo sapiens hyaluronan receptor (RHAM...    40   2.2  
gb|AF005654.1|AF005654  Homo sapiens                               40   2.2  
emb|AJ252088.1|SDU252088  Solanum dulcamara mRNA for gibbere...    40   2.2  
gb|AF038664.1|AF038664  Homo sapiens chromosome 18 map 18q11       40   2.2  
gb|AF037989.1|AF037989  Homo sapiens STAT-induced STAT inhib...    40   2.2  
gb|AF051151.1|AF051151  Homo sapiens chromosome 1 map 1q41-q42     40   2.2  
emb|AJ276857.1|KPN276857  Klebsiella pneumoniae partial SL04...    40   2.2  
emb|AJ276855.1|KPN276855  Klebsiella pneumoniae partial SL03...    40   2.2  
emb|AJ276466.1|KPN276466  Klebsiella pneumoniae contig regio...    40   2.2  
gb|AF079314.1|AF079314  Rattus norvegicus strain Wistar            40   2.2  
gb|AF072439.1|AF072439  Rattus norvegicus strain Sprague-Dawley    40   2.2  
dbj|AB013101.1|AB013101  Lycopersicon esculentum LE-ACO4 mRN...    40   2.2  
gb|AF000670.1|AF000670  Homo sapiens chromosome X map Xq26         40   2.2  
gb|AF057025.1|AF057025  Rattus norvegicus strain Sprague-Dawley    40   2.2  
gb|AF045229.1|AF045229  Homo sapiens                               40   2.2  
gb|AF042353.1|AF042353  Xenopus laevis                             40   2.2  
gb|U92642.1|HSU92642  Homo sapiens                                 40   2.2  
gb|AF035119.1|AF035119  Homo sapiens chromosome 8 map 8p21-p22     40   2.2  
emb|Y08890.1|HSRANBP5  Homo spaiens mRNA for Ran_GTP binding...    40   2.2  
gb|AF024536.1|AF024536  Danio rerio                                40   2.2  
gb|AF024535.1|AF024535  Danio rerio                                40   2.2  
emb|AJ293797.1|ATH293797  Arabidopsis thaliana mRNA for SC35...    40   2.2  
emb|AJ293760.1|ABI293760  Agaricus bisporus mRNA for putativ...    40   2.2  
emb|AJ293759.1|ABI293759  Agaricus bisporus mRNA for putativ...    40   2.2  
emb|AJ010750.1|RNO010750  Rattus norvegicus mRNA for Castrat...    40   2.2  
emb|AJ278170.1|MMU278170  Mus musculus mRNA for neuronal int...    40   2.2  
emb|AJ251833.1|HSA251833  Homo sapiens mRNA for hypothetical...    40   2.2  
gb|AF015768.1|AF015768  Mus musculus                               40   2.2  
gb|U82540.1|HMU82540  Herdmania momus unknown protein precur...    40   2.2  
emb|Y17775.1|HSY17775  Homo sapiens CACT gene, exon 1 and jo...    40   2.2  
gb|U63517.1|HMU63517  Herdmania momus serine proteinase (Hms...    40   2.2  
emb|AJ251660.1|GTI251660  Girardia tigrina mRNA for homeodom...    40   2.2  
gb|U80457.1|HSU80457  Human transcription factor SIM2 short ...    40   2.2  
gb|U80456.1|HSU80456  Human transcription factor SIM2 long f...    40   2.2  
dbj|AB072429.1|  Apis mellifera mRNA for IP3phosphatase, com...    40   2.2  
emb|AJ245736.1|DPU245736  Daphnia pulex mRNA for aconitase         40   2.2  
emb|AJ010090.1|ATH010090  Arabidopsis thaliana mRNA for MAP3...    40   2.2  
dbj|AB060695.1|  Homo sapiens TLR5 mRNA for Toll-like recept...    40   2.2  
gb|U81826.1|RNU81826  Rattus norvegicus clone PG23 mRNA sequ...    40   2.2  
emb|AJ238855.1|RNO238855  Rattus norvegicus mRNA for type A/...    40   2.2  
emb|AJ238854.1|RNO238854  Rattus norvegicus mRNA for type A/...    40   2.2  
gb|S82653.1|S82653  endothelin converting enzyme [guinea pig...    40   2.2  
emb|AJ001443.1|HSAJ1443  Homo sapiens mRNA for SAP 130 splic...    40   2.2  
emb|AJ011409.1|HSA011409  Homo sapiens mRNA for hypothetical...    40   2.2  
dbj|AB072357.1|AB072357  Homo sapiens mRNA for hSSH-1B, comp...    40   2.2  
gb|U54741.1|SMU54741  Sucrea maculata ribosomal protein L16 ...    40   2.2  
gb|U83599.1|HSU83599  Human alternatively spliced death doma...    40   2.2  
gb|U66839.1|HSU66839  Human MAP kinase 3b mRNA, complete cds       40   2.2  
gb|U61232.1|HSU61232  Human tubulin-folding cofactor E mRNA,...    40   2.2  
dbj|AB051296.1|AB051296  Oryza sativa OsNIF3 mRNA for bZIP t...    40   2.2  
dbj|AB051295.1|AB051295  Oryza sativa OsNIF2 mRNA for bZIP t...    40   2.2  
dbj|AB051294.1|AB051294  Oryza sativa OsNIF1 mRNA for bZIP t...    40   2.2  
dbj|AB057371.1|AB057371  Daucus carota CSCP mRNA for cystein...    40   2.2  
emb|AJ009799.1|GGA9799  Gallus gallus mRNA for ABC transport...    40   2.2  
emb|AJ004937.1|PSAJ4937  Phascolion strombi mRNA for cytopla...    40   2.2  
emb|AJ012375.1|HSA012375  Homo sapiens mRNA for SUI1 protein...    40   2.2  
gb|U62316.1|RNU62316  Rattus norvegicus strain Wistar              40   2.2  
emb|AJ223716.1|SAC223716  Squalus acanthias mRNA for sgk-2 s...    40   2.2  
emb|AJ223715.1|SAC223715  Squalus acanthias mRNA for sgk-1 s...    40   2.2  
emb|AJ001517.1|RNHERHAEM  Rattus norvegicus mRNA for heredit...    40   2.2  
dbj|AB017520.1|AB017520  Bombyx mori mRNA for Bacteriophage ...    40   2.2  
emb|X97991.1|MMCALCIT  M.musculus mRNA for calcitonin              40   2.2  
emb|Z93766.1|MDZ93766  M.domestica mRNA; small auxin up-regu...    40   2.2  
emb|Z93765.1|MDZ93765  M.domestica mRNA for lignostilbene di...    40   2.2  
dbj|AB026655.1|AB026655  Arabidopsis thaliana genomic DNA, c...    40   2.2  
dbj|AB041734.1|AB041734  Danio rerio orf mRNA, complete cds        40   2.2  
dbj|AB040807.1|AB040807  Rattus norvegicus MLS2s mRNA for me...    40   2.2  
dbj|AB044662.1|AB044662  Prunus persica PP-ACS1 mRNA for 1-a...    40   2.2  
dbj|AB040991.1|AB040991  Oryctolagus cuniculus mRNA for pros...    40   2.2  
emb|Y10319.1|HSCARNCAR  H.sapiens mRNA for carnitine carrier       40   2.2  
emb|Y11312.1|HSC2PI3K  H.sapiens mRNA for phosphoinositide 3...    40   2.2  
dbj|AB032612.1|AB032612  Pinctada maxima mRNA for N14 matrix...    40   2.2  
dbj|AB009308.2|AB009308  Hordeum vulgare mRNA for bpw2, comp...    40   2.2  
dbj|AB019046.1|AB019046  Mus musculus mRNA for receptor-acti...    40   2.2  
emb|Y12236.1|DECZSD  D.rerio mRNA for Cu/Zn-superoxide dismu...    40   2.2  
dbj|D88425.1|D88425  Cavia cobaya mRNA for serine/threoine k...    40   2.2  
dbj|D87747.1|D87747  Mus musculus mRNA for murine CXCR-4, co...    40   2.2  
dbj|D78130.1|D78130  Homo sapiens mRNA for squalene epoxidas...    40   2.2  
dbj|AB019574.1|AB019574  Homo sapiens mRNA expressed only in...    40   2.2  
dbj|AB019573.1|AB019573  Homo sapiens mRNA expressed only in...    40   2.2  
dbj|AB019572.1|AB019572  Homo sapiens mRNA expressed only in...    40   2.2  
dbj|AB019570.1|AB019570  Homo sapiens mRNA expressed only in...    40   2.2  
dbj|AB019569.1|AB019569  Homo sapiens mRNA expressed only in...    40   2.2  
dbj|AB019568.1|AB019568  Homo sapiens mRNA expressed only in...    40   2.2  
dbj|AB019566.1|AB019566  Homo sapiens mRNA expressed only in...    40   2.2  
dbj|AB019562.1|AB019562  Homo sapiens mRNA expressed only in...    40   2.2  
emb|Y10552.1|HSNCL3PRT  H.sapiens mRNA for calpain-like prot...    40   2.2  
emb|AJ000008.1|HSC2PI3KI  Homo sapiens mRNA for C2 domain co...    40   2.2  
dbj|AB000814.1|AB000814  Homo sapiens mRNA for BMAL1f, parti...    40   2.2  
gb|AC011594.8|  Homo sapiens 12p12-27.2-31.7 BAC RP11-18J10 ...    38   8.7  
gb|AF245220.1|  Homo sapiens                                       38   8.7  
gb|AC099402.2|  Oryza sativa chromosome 10 clone OSJNBa0022D...    38   8.7  
gb|AC016042.7|  Homo sapiens chromosome 10 clone RP11-87P3, ...    38   8.7  
>dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome
          Length = 134545

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                           
Query: 455   agccgcccgggttaataaaactgagaaaat 484
             ||||||||||||||||||||||||||||||
Sbjct: 78544 agccgcccgggttaataaaactgagaaaat 78515
>gb|AF326781.1|AF326781 Triticum monococcum actin (ACT-1) gene, partial cds; putative
             chromosome condensation factor (CCF), putative resistance
             protein (RGA-2), putative resistance protein (RGA2) and
             putative nodulin-like-like protein (NLL) gene, complete
             cds; and retrotransp>
          Length = 211009

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 275   gtctatggagcagaggcagttctccc 300
             ||||||||||||||||||||||||||
Sbjct: 68198 gtctatggagcagaggcagttctccc 68173
>gb|AF133492.1|AF133492 Humbertochloa greenwayi ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1218

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 473 gcccgggttaataaaactgagaaaat 498
>gb|AF133487.1|AF133487 Puelia olyriformis ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1217

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 473 gcccgggttaataaaactgagaaaat 498
>gb|AF133485.1|AF133485 Arundo donax ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1207

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 488 gcccgggttaataaaactgagaaaat 513
>gb|AF133483.1|AF133483 Zeugites pittieri ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1107

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 476 gcccgggttaataaaactgagaaaat 501
>gb|AF133473.1|AF133473 Otatea acuminata ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1185

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 466 gcccgggttaataaaactgagaaaat 491
>gb|AF133472.1|AF133472 Chusquea ramosissima ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1193

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 462 gcccgggttaataaaactgagaaaat 487
>gb|AF133471.1|AF133471 Glaziophyton mirabile ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1222

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 469 gcccgggttaataaaactgagaaaat 494
>gb|AF133470.1|AF133470 Bambusa longispiculata ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1206

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 467 gcccgggttaataaaactgagaaaat 492
>gb|AF133469.1|AF133469 Nastus elatus ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1211

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 472 gcccgggttaataaaactgagaaaat 497
>gb|AF133468.1|AF133468 Schizostachyum luzonicum ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1225

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 473 gcccgggttaataaaactgagaaaat 498
>gb|AF133467.1|AF133467 Phyllostachys pubescens ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1232

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 476 gcccgggttaataaaactgagaaaat 501
>gb|AF133466.1|AF133466 Pseudosasa japonica ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1225

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 476 gcccgggttaataaaactgagaaaat 501
>gb|AF133465.1|AF133465 Arundinaria gigantea ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1225

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 476 gcccgggttaataaaactgagaaaat 501
>gb|U62793.1|NAU62793 Neurolepis aperta ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, intron, partial
           sequence
          Length = 1052

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 439 gcccgggttaataaaactgagaaaat 464
>gb|U62792.1|CNU62792 Chusquea nudiramea ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, intron, partial
           sequence
          Length = 1034

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62791.1|CJU62791 Chusquea juergensii ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, intron, partial
           sequence
          Length = 1059

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 442 gcccgggttaataaaactgagaaaat 467
>gb|U62790.1|CVU62790 Chusquea vulcanalis ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, intron, partial
           sequence
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62789.1|CTU62789 Chusquea talamancensis ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, intron,
           partial sequence
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62788.1|CSU62788 Chusquea spencei ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, intron, partial
           sequence
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62787.1|CSU62787 Chusquea sp. A ribosomal protein L16 (rpl16) gene, chloroplast gene
           encoding chloroplast protein, intron, partial sequence
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 441 gcccgggttaataaaactgagaaaat 466
>gb|U62786.1|COU62786 Chusquea oxylepis ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, intron, partial
           sequence
          Length = 1032

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 440 gcccgggttaataaaactgagaaaat 465
>gb|U62785.1|COU62785 Chusquea oligophylla ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, intron,
           partial sequence
          Length = 1032

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 440 gcccgggttaataaaactgagaaaat 465
>gb|U62784.1|CEU62784 Chusquea exasperata ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, intron, partial
           sequence
          Length = 1032

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62783.1|CSU62783 Chusquea sp. B ribosomal protein L16 (rpl16) gene, chloroplast gene
           encoding chloroplast protein, intron, partial sequence
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62782.1|CTU62782 Chusquea tomentosa ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, intron, partial
           sequence
          Length = 1030

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 437 gcccgggttaataaaactgagaaaat 462
>gb|U62781.1|CSU62781 Chusquea scandens ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, intron, partial
           sequence
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62780.1|CAU62780 Chusquea aff. fendleri ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, intron,
           partial sequence
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54747.1|SLU54747 Schizostachyum luzonicum ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, partial
           intron
          Length = 1065

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 450 gcccgggttaataaaactgagaaaat 475
>gb|U54744.1|PPU54744 Phyllostachys pubescens ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, partial
           intron
          Length = 1072

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 453 gcccgggttaataaaactgagaaaat 478
>gb|U54743.1|PJU54743 Pseudosasa japonica ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, partial intron
          Length = 1065

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 453 gcccgggttaataaaactgagaaaat 478
>gb|U54749.1|OAU54749 Otatea acuminata ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, partial intron
          Length = 1025

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 443 gcccgggttaataaaactgagaaaat 468
>gb|U54746.1|NEU54746 Nastus elatus ribosomal protein L16 (rpl16) gene, chloroplast gene
           encoding chloroplast protein, partial intron
          Length = 1071

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 449 gcccgggttaataaaactgagaaaat 474
>gb|U54748.1|GMU54748 Glaziophyton mirabile ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, partial
           intron
          Length = 1068

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 446 gcccgggttaataaaactgagaaaat 471
>gb|U54755.1|CWU54755 Chusquea windischii ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, partial intron
          Length = 1034

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54752.1|CTU54752 Chusquea tessellata ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, partial intron
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54758.1|CSU54758 Chusquea sp. 'LC et al. 1309' ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, partial
           intron
          Length = 1035

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 439 gcccgggttaataaaactgagaaaat 464
>gb|U54754.1|CSU54754 Chusquea serpens ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, partial intron
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54753.1|CSU54753 Chusquea subtessellata ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, partial
           intron
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54751.1|CRU54751 Chusquea ramosissima ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, partial
           intron
          Length = 1032

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54756.1|CPU54756 Chusquea pinifolia ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, partial intron
          Length = 1038

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 442 gcccgggttaataaaactgagaaaat 467
>gb|U54760.1|CLU54760 Chusquea liebmannii ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, partial intron
          Length = 1032

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54759.1|CCU54759 Chusquea coronalis ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, partial intron
          Length = 1031

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 437 gcccgggttaataaaactgagaaaat 462
>gb|U54757.1|CBU54757 Chusquea bilimekii ribosomal protein L16 (rpl16) gene, chloroplast
           gene encoding chloroplast protein, partial intron
          Length = 1033

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 439 gcccgggttaataaaactgagaaaat 464
>gb|U54745.1|BLU54745 Bambusa longispiculata ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, partial
           intron
          Length = 1065

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 444 gcccgggttaataaaactgagaaaat 469
>gb|U54742.1|AGU54742 Arundinaria gigantea ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, partial
           intron
          Length = 1065

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||||
Sbjct: 453 gcccgggttaataaaactgagaaaat 478
>gb|AF133477.1|AF133477 Zea mays ribosomal protein 16 large subunit (rpl16) gene, intron,
           chloroplast sequence
          Length = 1190

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 461 ccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||
Sbjct: 450 ccgggttaataaaactgagaaaat 473
>emb|X86563.2|ZMA86563 Zea mays complete chloroplast genome
          Length = 140384

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 461   ccgggttaataaaactgagaaaat 484
             ||||||||||||||||||||||||
Sbjct: 80518 ccgggttaataaaactgagaaaat 80495
>gb|M15176.1|MZECPPG Zea mays chloroplast Eco x DNA
          Length = 1368

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 461 ccgggttaataaaactgagaaaat 484
           ||||||||||||||||||||||||
Sbjct: 59  ccgggttaataaaactgagaaaat 82
>gb|AF133461.1|AF133461 Buergersiochloa bambusoides ribosomal protein 16 large subunit
           (rpl16) gene, intron, chloroplast sequence
          Length = 1216

 Score = 46.1 bits (23), Expect = 0.036
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 462 cgggttaataaaactgagaaaat 484
           |||||||||||||||||||||||
Sbjct: 469 cgggttaataaaactgagaaaat 491
>gb|AF133458.1|AF133458 Leersia virginica ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1209

 Score = 46.1 bits (23), Expect = 0.036
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 460 cccgggttaataaaactgagaaa 482
           |||||||||||||||||||||||
Sbjct: 453 cccgggttaataaaactgagaaa 475
>gb|AF083221.1|AF083221 Takifugu rubripes
          Length = 43373

 Score = 46.1 bits (23), Expect = 0.036
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 95    cacccccagtccaatggacaggcagaacgagctaa 129
             |||||||||||||| || ||| |||||||||||||
Sbjct: 20488 cacccccagtccaacgggcagacagaacgagctaa 20522
>gb|AF095730.1|AF095730 Glycine max retroelement diaspora gag-pol polyprotein (gag-pol)
            pseudogene, partial sequence
          Length = 4152

 Score = 46.1 bits (23), Expect = 0.036
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 95   cacccccagtccaatggacaggcagaa 121
            ||||||||| |||||||||||||||||
Sbjct: 3936 cacccccagaccaatggacaggcagaa 3962
>emb|AJ293846.1|KPN293846 Klebsiella pneumoniae transposon TN3926 partial tra7 gene for
           transposase, contig region pSL007
          Length = 748

 Score = 46.1 bits (23), Expect = 0.036
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 1   gcgtggtcgcggccgaggtacca 23
           |||||||||||||||||||||||
Sbjct: 702 gcgtggtcgcggccgaggtacca 680

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 487 ctgcccgggcggccgctcgaa 507
           |||||||||||||||||||||
Sbjct: 50  ctgcccgggcggccgctcgaa 30
>emb|AJ276853.1|KPN276853 Klebsiella pneumoniae partial SL021 plasmid
          Length = 450

 Score = 46.1 bits (23), Expect = 0.036
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 1   gcgtggtcgcggccgaggtacca 23
           |||||||||||||||||||||||
Sbjct: 447 gcgtggtcgcggccgaggtacca 425
>dbj|AB019563.1|AB019563 Homo sapiens mRNA expressed only in placental villi, clone SMAP42
          Length = 333

 Score = 46.1 bits (23), Expect = 0.036
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 1   gcgtggtcgcggccgaggtacca 23
           |||||||||||||||||||||||
Sbjct: 332 gcgtggtcgcggccgaggtacca 310

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 487 ctgcccgggcggccgctcg 505
           |||||||||||||||||||
Sbjct: 19  ctgcccgggcggccgctcg 1
>gb|AF133491.1|AF133491 Joinvillea ascendens ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1229

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 463 gggttaataaaactgagaaaat 484
           ||||||||||||||||||||||
Sbjct: 458 gggttaataaaactgagaaaat 479
>gb|AF133490.1|AF133490 Streptochaeta angustifolia ribosomal protein 16 large subunit
           (rpl16) gene, intron, chloroplast sequence
          Length = 1243

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 463 gggttaataaaactgagaaaat 484
           ||||||||||||||||||||||
Sbjct: 496 gggttaataaaactgagaaaat 517
>gb|AF133488.1|AF133488 Pharus lappulaceus ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1182

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 463 gggttaataaaactgagaaaat 484
           ||||||||||||||||||||||
Sbjct: 437 gggttaataaaactgagaaaat 458
>gb|AF133486.1|AF133486 Molinia caerulea ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1211

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 463 gggttaataaaactgagaaaat 484
           ||||||||||||||||||||||
Sbjct: 483 gggttaataaaactgagaaaat 504
>gb|AF133484.1|AF133484 Phragmites australis ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1199

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 463 gggttaataaaactgagaaaat 484
           ||||||||||||||||||||||
Sbjct: 481 gggttaataaaactgagaaaat 502
>gb|AF133482.1|AF133482 Chasmanthium laxum ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1195

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 463 gggttaataaaactgagaaaat 484
           ||||||||||||||||||||||
Sbjct: 474 gggttaataaaactgagaaaat 495
>gb|AF133480.1|AF133480 Zoysia matrella ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1204

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           ||||| ||||||||||||||||||||
Sbjct: 476 gcccgcgttaataaaactgagaaaat 501
>gb|AF133474.1|AF133474 Poa pratensis ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1097

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 455 agccgcccgggttaataaaactgagaaaat 484
           ||||| |||| |||||||||||||||||||
Sbjct: 482 agccgaccggattaataaaactgagaaaat 511
>gb|AF133464.1|AF133464 Lithachne pauciflora ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1189

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 463 gggttaataaaactgagaaaat 484
           ||||||||||||||||||||||
Sbjct: 468 gggttaataaaactgagaaaat 489
>gb|AF133460.1|AF133460 Streptogyna americana ribosomal protein 16 large subunit (rpl16)
           gene, intron, chloroplast sequence
          Length = 1228

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 459 gcccgggttaataaaactgagaaaat 484
           |||||||||||||||||||| |||||
Sbjct: 471 gcccgggttaataaaactgataaaat 496
>emb|AJ315149.1|OMY315149 Oncorhynchus mykiss mRNA for CC chemokine
          Length = 548

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 1   gcgtggtcgcggccgaggtacc 22
           ||||||||||||||||||||||
Sbjct: 547 gcgtggtcgcggccgaggtacc 526

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 487 ctgcccgggcggccgctcg 505
           |||||||||||||||||||
Sbjct: 19  ctgcccgggcggccgctcg 1
>emb|AJ279850.1|MMU279850 Mus musculus partial mRNA for hypothetical protein, clone mvx2011
          Length = 256

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 481 aaataactgcccgggcggccgctcga 506
           ||||| ||||||||||||||||||||
Sbjct: 231 aaatacctgcccgggcggccgctcga 256
>emb|AJ293847.1|KPN293847 Klebsiella pneumoniae contig region pSL015
          Length = 700

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 1   gcgtggtcgcggccgaggtacc 22
           ||||||||||||||||||||||
Sbjct: 421 gcgtggtcgcggccgaggtacc 400
>emb|AJ276850.1|KPN276850 Klebsiella pneumoniae partial SL017 plasmid
          Length = 450

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 1   gcgtggtcgcggccgaggtacc 22
           ||||||||||||||||||||||
Sbjct: 302 gcgtggtcgcggccgaggtacc 281
>gb|U26024.1|BTU26024 Bos taurus pigpen mRNA, complete cds
          Length = 1779

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 485 aactgcccgggcggccgctcga 506
           ||||||||||||||||||||||
Sbjct: 22  aactgcccgggcggccgctcga 1
>gb|U54750.1|RPU54750 Rhipidocladum pittieri ribosomal protein L16 (rpl16) gene,
           chloroplast gene encoding chloroplast protein, partial
           intron
          Length = 1010

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 463 gggttaataaaactgagaaaat 484
           ||||||||||||||||||||||
Sbjct: 451 gggttaataaaactgagaaaat 472
>gb|AF271776.1|AF271776 Homo sapiens DC48 mRNA, complete cds
          Length = 1033

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 1   gcgtggtcgcggccgaggtac 21
           |||||||||||||||||||||
Sbjct: 864 gcgtggtcgcggccgaggtac 844
>gb|AF133478.1|AF133478 Sorghum bicolor ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1200

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 464 ggttaataaaactgagaaaat 484
           |||||||||||||||||||||
Sbjct: 478 ggttaataaaactgagaaaat 498
>gb|AF133475.1|AF133475 Avena sativa ribosomal protein 16 large subunit (rpl16) gene,
           intron, chloroplast sequence
          Length = 1187

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 464 ggttaataaaactgagaaaat 484
           |||||||||||||||||||||
Sbjct: 430 ggttaataaaactgagaaaat 450
>gb|AF151726.1|AF151726 Dianthus caryophyllus clone CFMI-6
          Length = 553

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 1   gcgtggtcgcggccgaggtac 21
           |||||||||||||||||||||
Sbjct: 529 gcgtggtcgcggccgaggtac 509
>emb|AJ310908.1|FVE310908 Fucus vesiculosus mRNA for ALA dehydratase (hemB gene)
          Length = 1530

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 487 ctgcccgggcggccgctcgaa 507
           |||||||||||||||||||||
Sbjct: 54  ctgcccgggcggccgctcgaa 34
>emb|AJ293850.1|KPN293850 Klebsiella pneumoniae partial EVGA gene for putative positive
          transcription regulator EVGA, contig region pSL042
          Length = 450

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 1  gcgtggtcgcggccgaggtac 21
          |||||||||||||||||||||
Sbjct: 57 gcgtggtcgcggccgaggtac 77
>emb|AJ293849.1|KPN293849 Klebsiella pneumoniae contig region pSL029
          Length = 720

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 1  gcgtggtcgcggccgaggtac 21
          |||||||||||||||||||||
Sbjct: 20 gcgtggtcgcggccgaggtac 40

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 407 ctgcccgggcggccgctcga 426
>emb|AJ293848.1|KPN293848 Klebsiella pneumoniae contig region pSL022
          Length = 739

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 487 ctgcccgggcggccgctcgaa 507
           |||||||||||||||||||||
Sbjct: 719 ctgcccgggcggccgctcgaa 739

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 1  gcgtggtcgcggccgaggtac 21
          |||||||||||||||||||||
Sbjct: 32 gcgtggtcgcggccgaggtac 52
>emb|AJ276849.1|KPN276849 Klebsiella pneumoniae partial SL016 plasmid
          Length = 450

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 487 ctgcccgggcggccgctcgaa 507
           |||||||||||||||||||||
Sbjct: 349 ctgcccgggcggccgctcgaa 369
>emb|AJ250102.1|OCU250102 Oryctolagus cuniculus partial mRNA for haptoglobin
          Length = 647

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 1  gcgtggtcgcggccgaggtac 21
          |||||||||||||||||||||
Sbjct: 3  gcgtggtcgcggccgaggtac 23
>emb|AJ276856.1|KPN276856 Klebsiella pneumoniae partial SL038 plasmid
          Length = 450

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 1   gcgtggtcgcggccgaggtac 21
           |||||||||||||||||||||
Sbjct: 425 gcgtggtcgcggccgaggtac 405
>dbj|AP003595.1|AP003595 Nostoc sp. PCC 7120 DNA, complete genome, section 15/19
          Length = 347550

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 466   ttaataaaactgagaaaataa 486
             |||||||||||||||||||||
Sbjct: 62570 ttaataaaactgagaaaataa 62550
>emb|AJ001134.1|SRMETPANS Strongyloides ratti mRNA for metallopanstimulin
          Length = 448

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 487 ctgcccgggcggccgctcgaa 507
           |||||||||||||||||||||
Sbjct: 88  ctgcccgggcggccgctcgaa 68
>dbj|AB047592.1|AB047592 Trichophyton mentagrophytes mRNA for alpha-crystallin-related
           protein, complete cds
          Length = 457

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 487 ctgcccgggcggccgctcgaa 507
           |||||||||||||||||||||
Sbjct: 25  ctgcccgggcggccgctcgaa 5
>dbj|AB019571.1|AB019571 Homo sapiens mRNA expressed only in placental villi, clone SMAP5
          Length = 1042

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 1  gcgtggtcgcggccgaggtac 21
          |||||||||||||||||||||
Sbjct: 2  gcgtggtcgcggccgaggtac 22
>ref|NM_139017.1| Homo sapiens similar to CRL3 protein (CRL3), mRNA
          Length = 1761

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 35  ctgcccgggcggccgctcga 16
>gb|AF097021.1| Homo sapiens
          Length = 2861

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 20  ctgcccgggcggccgctcga 1
>ref|NM_130806.2| Homo sapiens similar to G protein coupled receptor affecting
           testicular descent (H. sapiens) (GREAT), mRNA
          Length = 2838

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 34  ctgcccgggcggccgctcga 15
>gb|AF022770.2| Mus musculus strain BALB/c
          Length = 1543

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 48  ctgcccgggcggccgctcga 29
>ref|NM_007227.2| Homo sapiens G protein-coupled receptor 45 (GPR45), mRNA
          Length = 1777

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 38  ctgcccgggcggccgctcga 19
>gb|AC009957.11| Homo sapiens BAC clone RP11-285H23 from 2, complete sequence
          Length = 191119

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     agtggcacacccccagtcca 107
              ||||||||||||||||||||
Sbjct: 168251 agtggcacacccccagtcca 168270
>gb|AF403384.2| Homo sapiens chromosome 11 map 11q13
          Length = 2838

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 34  ctgcccgggcggccgctcga 15
>gb|AF075584.1|TGFA2 Homo sapiens transforming growth factor alpha precursor (TGFA)
           gene, exon 2 and partial cds
          Length = 758

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 31  ctgcccgggcggccgctcga 12
>gb|AF075583.1|TGFA1 Homo sapiens transforming growth factor alpha precursor (TGFA)
           gene, exon 1
          Length = 284

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 249 ctgcccgggcggccgctcga 268
>gb|AF106913.1|AF106913 Homo sapiens CRL3 protein (CRL3) mRNA, complete cds
          Length = 1761

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 35  ctgcccgggcggccgctcga 16
>gb|AF039086.1|AF039086 Pseudomicrothorax dubius articulin 1 mRNA, complete cds
          Length = 2084

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 ctgcccgggcggccgctcga 506
           ||||||||||||||||||||
Sbjct: 20  ctgcccgggcggccgctcga 1
>gb|AF107491.1|AF107491 Hexamita sp.
          Length = 1059

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 487  ctgcccgggcggccgctcga 506
            ||||||||||||||||||||
Sbjct: 1034 ctgcccgggcggccgctcga 1053
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) Posted date: May 13, 2002 3:54 AM Number of letters in database: 1,205,879,881 Number of sequences in database: 1,217,082 Lambda K H 1.37 0.711 0.00 Gapped Lambda K H 1.37 0.711 4.94e-324 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,030,074 Number of Sequences: 1217082 Number of extensions: 1030074 Number of successful extensions: 17532 Number of sequences better than 10.0: 275 length of query: 507 length of database: 5,500,847,177 effective HSP length: 21 effective length of query: 486 effective length of database: 5,475,288,455 effective search space: 2660990189130 effective search space used: 2660990189130 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)