The query sequence for this search has been filtered. Filtering
eliminates low complexity regions that commonly give spuriously high
scores that reflect compositional bias rather than significant
position-by-position alignment. Filtering can eliminate these potentially
confounding matches (e.g., hits against proline-rich regions or poly-A
tails) from the blast reports, leaving regions whose blast statistics
reflect the specificity of their pairwise alignment.
BLASTN 2.2.3 [Apr-24-2002]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Fgr-S3_1_B08_T7.seq Fgr-S3_1_B08_T7 LENGTH:507bp ;
DIRECTION:5 ; CLONE:Fgr-S3_1_B08 ; CLONELIB: n/a
(507 letters)
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
1,217,082 sequences; 1,205,879,881 total letters
Score E
Sequences producing significant alignments: (bits) Value
dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete... 60 2e-06
gb|AF326781.1|AF326781 Triticum monococcum actin (ACT-1) ge... 52 6e-04
gb|AF133492.1|AF133492 Humbertochloa greenwayi ribosomal pr... 52 6e-04
gb|AF133487.1|AF133487 Puelia olyriformis ribosomal protein... 52 6e-04
gb|AF133485.1|AF133485 Arundo donax ribosomal protein 16 la... 52 6e-04
gb|AF133483.1|AF133483 Zeugites pittieri ribosomal protein ... 52 6e-04
gb|AF133473.1|AF133473 Otatea acuminata ribosomal protein 1... 52 6e-04
gb|AF133472.1|AF133472 Chusquea ramosissima ribosomal prote... 52 6e-04
gb|AF133471.1|AF133471 Glaziophyton mirabile ribosomal prot... 52 6e-04
gb|AF133470.1|AF133470 Bambusa longispiculata ribosomal pro... 52 6e-04
gb|AF133469.1|AF133469 Nastus elatus ribosomal protein 16 l... 52 6e-04
gb|AF133468.1|AF133468 Schizostachyum luzonicum ribosomal p... 52 6e-04
gb|AF133467.1|AF133467 Phyllostachys pubescens ribosomal pr... 52 6e-04
gb|AF133466.1|AF133466 Pseudosasa japonica ribosomal protei... 52 6e-04
gb|AF133465.1|AF133465 Arundinaria gigantea ribosomal prote... 52 6e-04
gb|U62793.1|NAU62793 Neurolepis aperta ribosomal protein L1... 52 6e-04
gb|U62792.1|CNU62792 Chusquea nudiramea ribosomal protein L... 52 6e-04
gb|U62791.1|CJU62791 Chusquea juergensii ribosomal protein ... 52 6e-04
gb|U62790.1|CVU62790 Chusquea vulcanalis ribosomal protein ... 52 6e-04
gb|U62789.1|CTU62789 Chusquea talamancensis ribosomal prote... 52 6e-04
gb|U62788.1|CSU62788 Chusquea spencei ribosomal protein L16... 52 6e-04
gb|U62787.1|CSU62787 Chusquea sp. A ribosomal protein L16 (... 52 6e-04
gb|U62786.1|COU62786 Chusquea oxylepis ribosomal protein L1... 52 6e-04
gb|U62785.1|COU62785 Chusquea oligophylla ribosomal protein... 52 6e-04
gb|U62784.1|CEU62784 Chusquea exasperata ribosomal protein ... 52 6e-04
gb|U62783.1|CSU62783 Chusquea sp. B ribosomal protein L16 (... 52 6e-04
gb|U62782.1|CTU62782 Chusquea tomentosa ribosomal protein L... 52 6e-04
gb|U62781.1|CSU62781 Chusquea scandens ribosomal protein L1... 52 6e-04
gb|U62780.1|CAU62780 Chusquea aff. fendleri ribosomal prote... 52 6e-04
gb|U54747.1|SLU54747 Schizostachyum luzonicum ribosomal pro... 52 6e-04
gb|U54744.1|PPU54744 Phyllostachys pubescens ribosomal prot... 52 6e-04
gb|U54743.1|PJU54743 Pseudosasa japonica ribosomal protein ... 52 6e-04
gb|U54749.1|OAU54749 Otatea acuminata ribosomal protein L16... 52 6e-04
gb|U54746.1|NEU54746 Nastus elatus ribosomal protein L16 (r... 52 6e-04
gb|U54748.1|GMU54748 Glaziophyton mirabile ribosomal protei... 52 6e-04
gb|U54755.1|CWU54755 Chusquea windischii ribosomal protein ... 52 6e-04
gb|U54752.1|CTU54752 Chusquea tessellata ribosomal protein ... 52 6e-04
gb|U54758.1|CSU54758 Chusquea sp. 'LC et al. 1309' ribosoma... 52 6e-04
gb|U54754.1|CSU54754 Chusquea serpens ribosomal protein L16... 52 6e-04
gb|U54753.1|CSU54753 Chusquea subtessellata ribosomal prote... 52 6e-04
gb|U54751.1|CRU54751 Chusquea ramosissima ribosomal protein... 52 6e-04
gb|U54756.1|CPU54756 Chusquea pinifolia ribosomal protein L... 52 6e-04
gb|U54760.1|CLU54760 Chusquea liebmannii ribosomal protein ... 52 6e-04
gb|U54759.1|CCU54759 Chusquea coronalis ribosomal protein L... 52 6e-04
gb|U54757.1|CBU54757 Chusquea bilimekii ribosomal protein L... 52 6e-04
gb|U54745.1|BLU54745 Bambusa longispiculata ribosomal prote... 52 6e-04
gb|U54742.1|AGU54742 Arundinaria gigantea ribosomal protein... 52 6e-04
gb|AF133477.1|AF133477 Zea mays ribosomal protein 16 large ... 48 0.009
emb|X86563.2|ZMA86563 Zea mays complete chloroplast genome 48 0.009
gb|M15176.1|MZECPPG Zea mays chloroplast Eco x DNA 48 0.009
gb|AF133461.1|AF133461 Buergersiochloa bambusoides ribosoma... 46 0.036
gb|AF133458.1|AF133458 Leersia virginica ribosomal protein ... 46 0.036
gb|AF083221.1|AF083221 Takifugu rubripes 46 0.036
gb|AF095730.1|AF095730 Glycine max retroelement diaspora ga... 46 0.036
emb|AJ293846.1|KPN293846 Klebsiella pneumoniae transposon T... 46 0.036
emb|AJ276853.1|KPN276853 Klebsiella pneumoniae partial SL02... 46 0.036
dbj|AB019563.1|AB019563 Homo sapiens mRNA expressed only in... 46 0.036
gb|AF133491.1|AF133491 Joinvillea ascendens ribosomal prote... 44 0.14
gb|AF133490.1|AF133490 Streptochaeta angustifolia ribosomal... 44 0.14
gb|AF133488.1|AF133488 Pharus lappulaceus ribosomal protein... 44 0.14
gb|AF133486.1|AF133486 Molinia caerulea ribosomal protein 1... 44 0.14
gb|AF133484.1|AF133484 Phragmites australis ribosomal prote... 44 0.14
gb|AF133482.1|AF133482 Chasmanthium laxum ribosomal protein... 44 0.14
gb|AF133480.1|AF133480 Zoysia matrella ribosomal protein 16... 44 0.14
gb|AF133474.1|AF133474 Poa pratensis ribosomal protein 16 l... 44 0.14
gb|AF133464.1|AF133464 Lithachne pauciflora ribosomal prote... 44 0.14
gb|AF133460.1|AF133460 Streptogyna americana ribosomal prot... 44 0.14
emb|AJ315149.1|OMY315149 Oncorhynchus mykiss mRNA for CC ch... 44 0.14
emb|AJ279850.1|MMU279850 Mus musculus partial mRNA for hypo... 44 0.14
emb|AJ293847.1|KPN293847 Klebsiella pneumoniae contig regio... 44 0.14
emb|AJ276850.1|KPN276850 Klebsiella pneumoniae partial SL01... 44 0.14
gb|U26024.1|BTU26024 Bos taurus pigpen mRNA, complete cds 44 0.14
gb|U54750.1|RPU54750 Rhipidocladum pittieri ribosomal prote... 44 0.14
gb|AF271776.1|AF271776 Homo sapiens DC48 mRNA, complete cds 42 0.56
gb|AF133478.1|AF133478 Sorghum bicolor ribosomal protein 16... 42 0.56
gb|AF133475.1|AF133475 Avena sativa ribosomal protein 16 la... 42 0.56
gb|AF151726.1|AF151726 Dianthus caryophyllus clone CFMI-6 42 0.56
emb|AJ310908.1|FVE310908 Fucus vesiculosus mRNA for ALA deh... 42 0.56
emb|AJ293850.1|KPN293850 Klebsiella pneumoniae partial EVGA... 42 0.56
emb|AJ293849.1|KPN293849 Klebsiella pneumoniae contig regio... 42 0.56
emb|AJ293848.1|KPN293848 Klebsiella pneumoniae contig regio... 42 0.56
emb|AJ276849.1|KPN276849 Klebsiella pneumoniae partial SL01... 42 0.56
emb|AJ250102.1|OCU250102 Oryctolagus cuniculus partial mRNA... 42 0.56
emb|AJ276856.1|KPN276856 Klebsiella pneumoniae partial SL03... 42 0.56
dbj|AP003595.1|AP003595 Nostoc sp. PCC 7120 DNA, complete g... 42 0.56
emb|AJ001134.1|SRMETPANS Strongyloides ratti mRNA for metal... 42 0.56
dbj|AB047592.1|AB047592 Trichophyton mentagrophytes mRNA fo... 42 0.56
dbj|AB019571.1|AB019571 Homo sapiens mRNA expressed only in... 42 0.56
ref|NM_139017.1| Homo sapiens similar to CRL3 protein (CRL3... 40 2.2
gb|AF097021.1| Homo sapiens 40 2.2
ref|NM_130806.2| Homo sapiens similar to G protein coupled ... 40 2.2
gb|AF022770.2| Mus musculus strain BALB/c 40 2.2
ref|NM_007227.2| Homo sapiens G protein-coupled receptor 45... 40 2.2
gb|AC009957.11| Homo sapiens BAC clone RP11-285H23 from 2, ... 40 2.2
gb|AF403384.2| Homo sapiens chromosome 11 map 11q13 40 2.2
gb|AF075584.1|TGFA2 Homo sapiens transforming growth factor... 40 2.2
gb|AF075583.1|TGFA1 Homo sapiens transforming growth factor... 40 2.2
gb|AF106913.1|AF106913 Homo sapiens CRL3 protein (CRL3) mRN... 40 2.2
gb|AF039086.1|AF039086 Pseudomicrothorax dubius articulin 1... 40 2.2
gb|AF107491.1|AF107491 Hexamita sp. 40 2.2
gb|AF050198.1|AF050198 Homo sapiens 40 2.2
gb|AF139835.1|AF139835 Populus tremula x Populus tremuloides 40 2.2
gb|AF042168.1|AF042168 Onchocerca volvulus 40 2.2
gb|AF074706.1|AF074706 Bos taurus 40 2.2
emb|AJ318062.1|CNE318062 Cryptococcus neoformans mRNA for A... 40 2.2
emb|AJ130894.1|HSA130894 Homo sapiens mRNA for transcriptio... 40 2.2
emb|AJ306902.1|RCO306902 Ricinus communis mRNA for iron tra... 40 2.2
gb|AF072534.1|AF072534 Capsicum annuum 40 2.2
emb|AJ133126.1|RNO33126 Rattus norvegicus mRNA for kelch-li... 40 2.2
gb|AF133476.1|AF133476 Brachyelytrum erectum ribosomal prot... 40 2.2
gb|AF133463.1|AF133463 Sucrea maculata ribosomal protein 16... 40 2.2
gb|AF133675.1|AF133675 Populus tremula x Populus tremuloides 40 2.2
emb|AJ416426.1|MMU416426 Mus musculus mRNA for damaged-DNA ... 40 2.2
gb|AF117260.1|AF117260 Ceratopteris richardii ribosomal pro... 40 2.2
gb|AF026274.1|AF026274 Mus musculus 40 2.2
gb|AF128458.1|AF128458 Homo sapiens 40 2.2
gb|L77146.1|ZEFHSC7R Danio rerio heat shock cognate (hsc70)... 40 2.2
gb|AF012324.1|AF012324 Mus musculus 40 2.2
gb|AF169248.2|AF169248 Opsanus beta 40 2.2
gb|AF002248.2|AF002248 Pisum sativum 40 2.2
emb|AJ292755.1|AGA292755 Anopheles gambiae mRNA for integri... 40 2.2
gb|AF106660.1|AF106660 Lycopersicon esculentum 40 2.2
emb|AJ290944.2|MMU290944 Mus musculus mRNA for a stretch re... 40 2.2
emb|AJ291825.1|LPE291825 Lolium perenne mRNA for oxalate ox... 40 2.2
gb|AF127772.1|AF127772 Homo sapiens cell-line E8CASS clone ... 40 2.2
gb|AF133731.2|AF133731 Rattus norvegicus strain Copenhagen 40 2.2
gb|AF112153.1|AF112153 Rattus norvegicus 40 2.2
emb|AJ279852.1|MMU279852 Mus musculus partial mRNA for hypo... 40 2.2
emb|AJ279849.1|MMU279849 Mus musculus partial mRNA for hypo... 40 2.2
emb|AJ279847.1|MMU279847 Mus musculus partial mRNA for hypo... 40 2.2
emb|AJ279846.1|MMU279846 Mus musculus partial mRNA for hypo... 40 2.2
emb|AJ279839.1|MMU279839 Mus musculus partial mRNA for hypo... 40 2.2
gb|U81599.1|HSU81599 Homo sapiens chromosome 17 map 17q21.2 40 2.2
gb|AF125392.1|AF125392 Homo sapiens 40 2.2
gb|AF118559.1|AF118559 Avena fatua strain AN265 40 2.2
gb|AF098517.1|AF098517 Penicillium citrinum strain 52-5 40 2.2
gb|AF095771.1|AF095771 Homo sapiens 40 2.2
emb|AJ006225.1|MCR6225 Mesembryanthemum crystallinum mRNA f... 40 2.2
gb|AF061027.1|AF061027 Vernicia fordii 40 2.2
gb|U58918.1|ATU58918 Arabidopsis thaliana MEK kinase (MAP3K... 40 2.2
gb|U55215.1|CPU55215 Cavia porcellus interleukin-5 receptor... 40 2.2
gb|AF033850.1|AF033850 Homo sapiens 40 2.2
emb|AL445423.13|AL445423 Human DNA sequence from clone RP11... 40 2.2
gb|AF067650.1|AF067650 Rattus norvegicus strain Sprague-Dawley 40 2.2
gb|AF039201.1| Pinus caribaea 40 2.2
gb|AF053405.1|AF053405 Mus musculus 40 2.2
emb|AJ300524.2|PEU300524 Populus euramericana mRNA for puta... 40 2.2
gb|AF074720.1|AF074720 Dicentrarchus labrax 40 2.2
emb|AJ272202.1|ATH272202 Arabidopsis thaliana mRNA for mito... 40 2.2
gb|AF061514.1|AF061514 Gossypium hirsutum 40 2.2
emb|AJ293762.1|ABI293762 Snythetic construct chimeric mRNA ... 40 2.2
gb|AF093414.1|AF093414 Saguinus oedipus 40 2.2
gb|AF064741.1|AF064741 Sus scrofa 40 2.2
gb|AF084928.1|AF084928 Homo sapiens erythroblast macrophage... 40 2.2
gb|AF061266.1|AF061266 Rattus norvegicus strain Sprague-Dawley 40 2.2
gb|AF093139.1|AF093139 Rattus norvegicus strain Sprague Dawley 40 2.2
gb|U77330.1|MMU77330 Mus musculus extracellular matrix prot... 40 2.2
gb|U29343.1|HSU29343 Homo sapiens hyaluronan receptor (RHAM... 40 2.2
gb|AF005654.1|AF005654 Homo sapiens 40 2.2
emb|AJ252088.1|SDU252088 Solanum dulcamara mRNA for gibbere... 40 2.2
gb|AF038664.1|AF038664 Homo sapiens chromosome 18 map 18q11 40 2.2
gb|AF037989.1|AF037989 Homo sapiens STAT-induced STAT inhib... 40 2.2
gb|AF051151.1|AF051151 Homo sapiens chromosome 1 map 1q41-q42 40 2.2
emb|AJ276857.1|KPN276857 Klebsiella pneumoniae partial SL04... 40 2.2
emb|AJ276855.1|KPN276855 Klebsiella pneumoniae partial SL03... 40 2.2
emb|AJ276466.1|KPN276466 Klebsiella pneumoniae contig regio... 40 2.2
gb|AF079314.1|AF079314 Rattus norvegicus strain Wistar 40 2.2
gb|AF072439.1|AF072439 Rattus norvegicus strain Sprague-Dawley 40 2.2
dbj|AB013101.1|AB013101 Lycopersicon esculentum LE-ACO4 mRN... 40 2.2
gb|AF000670.1|AF000670 Homo sapiens chromosome X map Xq26 40 2.2
gb|AF057025.1|AF057025 Rattus norvegicus strain Sprague-Dawley 40 2.2
gb|AF045229.1|AF045229 Homo sapiens 40 2.2
gb|AF042353.1|AF042353 Xenopus laevis 40 2.2
gb|U92642.1|HSU92642 Homo sapiens 40 2.2
gb|AF035119.1|AF035119 Homo sapiens chromosome 8 map 8p21-p22 40 2.2
emb|Y08890.1|HSRANBP5 Homo spaiens mRNA for Ran_GTP binding... 40 2.2
gb|AF024536.1|AF024536 Danio rerio 40 2.2
gb|AF024535.1|AF024535 Danio rerio 40 2.2
emb|AJ293797.1|ATH293797 Arabidopsis thaliana mRNA for SC35... 40 2.2
emb|AJ293760.1|ABI293760 Agaricus bisporus mRNA for putativ... 40 2.2
emb|AJ293759.1|ABI293759 Agaricus bisporus mRNA for putativ... 40 2.2
emb|AJ010750.1|RNO010750 Rattus norvegicus mRNA for Castrat... 40 2.2
emb|AJ278170.1|MMU278170 Mus musculus mRNA for neuronal int... 40 2.2
emb|AJ251833.1|HSA251833 Homo sapiens mRNA for hypothetical... 40 2.2
gb|AF015768.1|AF015768 Mus musculus 40 2.2
gb|U82540.1|HMU82540 Herdmania momus unknown protein precur... 40 2.2
emb|Y17775.1|HSY17775 Homo sapiens CACT gene, exon 1 and jo... 40 2.2
gb|U63517.1|HMU63517 Herdmania momus serine proteinase (Hms... 40 2.2
emb|AJ251660.1|GTI251660 Girardia tigrina mRNA for homeodom... 40 2.2
gb|U80457.1|HSU80457 Human transcription factor SIM2 short ... 40 2.2
gb|U80456.1|HSU80456 Human transcription factor SIM2 long f... 40 2.2
dbj|AB072429.1| Apis mellifera mRNA for IP3phosphatase, com... 40 2.2
emb|AJ245736.1|DPU245736 Daphnia pulex mRNA for aconitase 40 2.2
emb|AJ010090.1|ATH010090 Arabidopsis thaliana mRNA for MAP3... 40 2.2
dbj|AB060695.1| Homo sapiens TLR5 mRNA for Toll-like recept... 40 2.2
gb|U81826.1|RNU81826 Rattus norvegicus clone PG23 mRNA sequ... 40 2.2
emb|AJ238855.1|RNO238855 Rattus norvegicus mRNA for type A/... 40 2.2
emb|AJ238854.1|RNO238854 Rattus norvegicus mRNA for type A/... 40 2.2
gb|S82653.1|S82653 endothelin converting enzyme [guinea pig... 40 2.2
emb|AJ001443.1|HSAJ1443 Homo sapiens mRNA for SAP 130 splic... 40 2.2
emb|AJ011409.1|HSA011409 Homo sapiens mRNA for hypothetical... 40 2.2
dbj|AB072357.1|AB072357 Homo sapiens mRNA for hSSH-1B, comp... 40 2.2
gb|U54741.1|SMU54741 Sucrea maculata ribosomal protein L16 ... 40 2.2
gb|U83599.1|HSU83599 Human alternatively spliced death doma... 40 2.2
gb|U66839.1|HSU66839 Human MAP kinase 3b mRNA, complete cds 40 2.2
gb|U61232.1|HSU61232 Human tubulin-folding cofactor E mRNA,... 40 2.2
dbj|AB051296.1|AB051296 Oryza sativa OsNIF3 mRNA for bZIP t... 40 2.2
dbj|AB051295.1|AB051295 Oryza sativa OsNIF2 mRNA for bZIP t... 40 2.2
dbj|AB051294.1|AB051294 Oryza sativa OsNIF1 mRNA for bZIP t... 40 2.2
dbj|AB057371.1|AB057371 Daucus carota CSCP mRNA for cystein... 40 2.2
emb|AJ009799.1|GGA9799 Gallus gallus mRNA for ABC transport... 40 2.2
emb|AJ004937.1|PSAJ4937 Phascolion strombi mRNA for cytopla... 40 2.2
emb|AJ012375.1|HSA012375 Homo sapiens mRNA for SUI1 protein... 40 2.2
gb|U62316.1|RNU62316 Rattus norvegicus strain Wistar 40 2.2
emb|AJ223716.1|SAC223716 Squalus acanthias mRNA for sgk-2 s... 40 2.2
emb|AJ223715.1|SAC223715 Squalus acanthias mRNA for sgk-1 s... 40 2.2
emb|AJ001517.1|RNHERHAEM Rattus norvegicus mRNA for heredit... 40 2.2
dbj|AB017520.1|AB017520 Bombyx mori mRNA for Bacteriophage ... 40 2.2
emb|X97991.1|MMCALCIT M.musculus mRNA for calcitonin 40 2.2
emb|Z93766.1|MDZ93766 M.domestica mRNA; small auxin up-regu... 40 2.2
emb|Z93765.1|MDZ93765 M.domestica mRNA for lignostilbene di... 40 2.2
dbj|AB026655.1|AB026655 Arabidopsis thaliana genomic DNA, c... 40 2.2
dbj|AB041734.1|AB041734 Danio rerio orf mRNA, complete cds 40 2.2
dbj|AB040807.1|AB040807 Rattus norvegicus MLS2s mRNA for me... 40 2.2
dbj|AB044662.1|AB044662 Prunus persica PP-ACS1 mRNA for 1-a... 40 2.2
dbj|AB040991.1|AB040991 Oryctolagus cuniculus mRNA for pros... 40 2.2
emb|Y10319.1|HSCARNCAR H.sapiens mRNA for carnitine carrier 40 2.2
emb|Y11312.1|HSC2PI3K H.sapiens mRNA for phosphoinositide 3... 40 2.2
dbj|AB032612.1|AB032612 Pinctada maxima mRNA for N14 matrix... 40 2.2
dbj|AB009308.2|AB009308 Hordeum vulgare mRNA for bpw2, comp... 40 2.2
dbj|AB019046.1|AB019046 Mus musculus mRNA for receptor-acti... 40 2.2
emb|Y12236.1|DECZSD D.rerio mRNA for Cu/Zn-superoxide dismu... 40 2.2
dbj|D88425.1|D88425 Cavia cobaya mRNA for serine/threoine k... 40 2.2
dbj|D87747.1|D87747 Mus musculus mRNA for murine CXCR-4, co... 40 2.2
dbj|D78130.1|D78130 Homo sapiens mRNA for squalene epoxidas... 40 2.2
dbj|AB019574.1|AB019574 Homo sapiens mRNA expressed only in... 40 2.2
dbj|AB019573.1|AB019573 Homo sapiens mRNA expressed only in... 40 2.2
dbj|AB019572.1|AB019572 Homo sapiens mRNA expressed only in... 40 2.2
dbj|AB019570.1|AB019570 Homo sapiens mRNA expressed only in... 40 2.2
dbj|AB019569.1|AB019569 Homo sapiens mRNA expressed only in... 40 2.2
dbj|AB019568.1|AB019568 Homo sapiens mRNA expressed only in... 40 2.2
dbj|AB019566.1|AB019566 Homo sapiens mRNA expressed only in... 40 2.2
dbj|AB019562.1|AB019562 Homo sapiens mRNA expressed only in... 40 2.2
emb|Y10552.1|HSNCL3PRT H.sapiens mRNA for calpain-like prot... 40 2.2
emb|AJ000008.1|HSC2PI3KI Homo sapiens mRNA for C2 domain co... 40 2.2
dbj|AB000814.1|AB000814 Homo sapiens mRNA for BMAL1f, parti... 40 2.2
gb|AC011594.8| Homo sapiens 12p12-27.2-31.7 BAC RP11-18J10 ... 38 8.7
gb|AF245220.1| Homo sapiens 38 8.7
gb|AC099402.2| Oryza sativa chromosome 10 clone OSJNBa0022D... 38 8.7
gb|AC016042.7| Homo sapiens chromosome 10 clone RP11-87P3, ... 38 8.7
>dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome
Length = 134545
Score = 60.0 bits (30), Expect = 2e-06
Identities = 30/30 (100%)
Strand = Plus / Minus
Query: 455 agccgcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||||||
Sbjct: 78544 agccgcccgggttaataaaactgagaaaat 78515
>gb|AF326781.1|AF326781 Triticum monococcum actin (ACT-1) gene, partial cds; putative
chromosome condensation factor (CCF), putative resistance
protein (RGA-2), putative resistance protein (RGA2) and
putative nodulin-like-like protein (NLL) gene, complete
cds; and retrotransp>
Length = 211009
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 275 gtctatggagcagaggcagttctccc 300
||||||||||||||||||||||||||
Sbjct: 68198 gtctatggagcagaggcagttctccc 68173
>gb|AF133492.1|AF133492 Humbertochloa greenwayi ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1218
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 473 gcccgggttaataaaactgagaaaat 498
>gb|AF133487.1|AF133487 Puelia olyriformis ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1217
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 473 gcccgggttaataaaactgagaaaat 498
>gb|AF133485.1|AF133485 Arundo donax ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1207
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 488 gcccgggttaataaaactgagaaaat 513
>gb|AF133483.1|AF133483 Zeugites pittieri ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1107
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 476 gcccgggttaataaaactgagaaaat 501
>gb|AF133473.1|AF133473 Otatea acuminata ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1185
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 466 gcccgggttaataaaactgagaaaat 491
>gb|AF133472.1|AF133472 Chusquea ramosissima ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1193
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 462 gcccgggttaataaaactgagaaaat 487
>gb|AF133471.1|AF133471 Glaziophyton mirabile ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1222
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 469 gcccgggttaataaaactgagaaaat 494
>gb|AF133470.1|AF133470 Bambusa longispiculata ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1206
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 467 gcccgggttaataaaactgagaaaat 492
>gb|AF133469.1|AF133469 Nastus elatus ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1211
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 472 gcccgggttaataaaactgagaaaat 497
>gb|AF133468.1|AF133468 Schizostachyum luzonicum ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1225
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 473 gcccgggttaataaaactgagaaaat 498
>gb|AF133467.1|AF133467 Phyllostachys pubescens ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1232
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 476 gcccgggttaataaaactgagaaaat 501
>gb|AF133466.1|AF133466 Pseudosasa japonica ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1225
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 476 gcccgggttaataaaactgagaaaat 501
>gb|AF133465.1|AF133465 Arundinaria gigantea ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1225
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 476 gcccgggttaataaaactgagaaaat 501
>gb|U62793.1|NAU62793 Neurolepis aperta ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, intron, partial
sequence
Length = 1052
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 439 gcccgggttaataaaactgagaaaat 464
>gb|U62792.1|CNU62792 Chusquea nudiramea ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, intron, partial
sequence
Length = 1034
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62791.1|CJU62791 Chusquea juergensii ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, intron, partial
sequence
Length = 1059
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 442 gcccgggttaataaaactgagaaaat 467
>gb|U62790.1|CVU62790 Chusquea vulcanalis ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, intron, partial
sequence
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62789.1|CTU62789 Chusquea talamancensis ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, intron,
partial sequence
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62788.1|CSU62788 Chusquea spencei ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, intron, partial
sequence
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62787.1|CSU62787 Chusquea sp. A ribosomal protein L16 (rpl16) gene, chloroplast gene
encoding chloroplast protein, intron, partial sequence
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 441 gcccgggttaataaaactgagaaaat 466
>gb|U62786.1|COU62786 Chusquea oxylepis ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, intron, partial
sequence
Length = 1032
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 440 gcccgggttaataaaactgagaaaat 465
>gb|U62785.1|COU62785 Chusquea oligophylla ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, intron,
partial sequence
Length = 1032
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 440 gcccgggttaataaaactgagaaaat 465
>gb|U62784.1|CEU62784 Chusquea exasperata ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, intron, partial
sequence
Length = 1032
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62783.1|CSU62783 Chusquea sp. B ribosomal protein L16 (rpl16) gene, chloroplast gene
encoding chloroplast protein, intron, partial sequence
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62782.1|CTU62782 Chusquea tomentosa ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, intron, partial
sequence
Length = 1030
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 437 gcccgggttaataaaactgagaaaat 462
>gb|U62781.1|CSU62781 Chusquea scandens ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, intron, partial
sequence
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U62780.1|CAU62780 Chusquea aff. fendleri ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, intron,
partial sequence
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54747.1|SLU54747 Schizostachyum luzonicum ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, partial
intron
Length = 1065
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 450 gcccgggttaataaaactgagaaaat 475
>gb|U54744.1|PPU54744 Phyllostachys pubescens ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, partial
intron
Length = 1072
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 453 gcccgggttaataaaactgagaaaat 478
>gb|U54743.1|PJU54743 Pseudosasa japonica ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, partial intron
Length = 1065
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 453 gcccgggttaataaaactgagaaaat 478
>gb|U54749.1|OAU54749 Otatea acuminata ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, partial intron
Length = 1025
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 443 gcccgggttaataaaactgagaaaat 468
>gb|U54746.1|NEU54746 Nastus elatus ribosomal protein L16 (rpl16) gene, chloroplast gene
encoding chloroplast protein, partial intron
Length = 1071
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 449 gcccgggttaataaaactgagaaaat 474
>gb|U54748.1|GMU54748 Glaziophyton mirabile ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, partial
intron
Length = 1068
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 446 gcccgggttaataaaactgagaaaat 471
>gb|U54755.1|CWU54755 Chusquea windischii ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, partial intron
Length = 1034
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54752.1|CTU54752 Chusquea tessellata ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, partial intron
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54758.1|CSU54758 Chusquea sp. 'LC et al. 1309' ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, partial
intron
Length = 1035
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 439 gcccgggttaataaaactgagaaaat 464
>gb|U54754.1|CSU54754 Chusquea serpens ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, partial intron
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54753.1|CSU54753 Chusquea subtessellata ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, partial
intron
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54751.1|CRU54751 Chusquea ramosissima ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, partial
intron
Length = 1032
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54756.1|CPU54756 Chusquea pinifolia ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, partial intron
Length = 1038
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 442 gcccgggttaataaaactgagaaaat 467
>gb|U54760.1|CLU54760 Chusquea liebmannii ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, partial intron
Length = 1032
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 438 gcccgggttaataaaactgagaaaat 463
>gb|U54759.1|CCU54759 Chusquea coronalis ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, partial intron
Length = 1031
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 437 gcccgggttaataaaactgagaaaat 462
>gb|U54757.1|CBU54757 Chusquea bilimekii ribosomal protein L16 (rpl16) gene, chloroplast
gene encoding chloroplast protein, partial intron
Length = 1033
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 439 gcccgggttaataaaactgagaaaat 464
>gb|U54745.1|BLU54745 Bambusa longispiculata ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, partial
intron
Length = 1065
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 444 gcccgggttaataaaactgagaaaat 469
>gb|U54742.1|AGU54742 Arundinaria gigantea ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, partial
intron
Length = 1065
Score = 52.0 bits (26), Expect = 6e-04
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||||
Sbjct: 453 gcccgggttaataaaactgagaaaat 478
>gb|AF133477.1|AF133477 Zea mays ribosomal protein 16 large subunit (rpl16) gene, intron,
chloroplast sequence
Length = 1190
Score = 48.1 bits (24), Expect = 0.009
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 461 ccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||
Sbjct: 450 ccgggttaataaaactgagaaaat 473
>emb|X86563.2|ZMA86563 Zea mays complete chloroplast genome
Length = 140384
Score = 48.1 bits (24), Expect = 0.009
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 461 ccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||
Sbjct: 80518 ccgggttaataaaactgagaaaat 80495
>gb|M15176.1|MZECPPG Zea mays chloroplast Eco x DNA
Length = 1368
Score = 48.1 bits (24), Expect = 0.009
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 461 ccgggttaataaaactgagaaaat 484
||||||||||||||||||||||||
Sbjct: 59 ccgggttaataaaactgagaaaat 82
>gb|AF133461.1|AF133461 Buergersiochloa bambusoides ribosomal protein 16 large subunit
(rpl16) gene, intron, chloroplast sequence
Length = 1216
Score = 46.1 bits (23), Expect = 0.036
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 462 cgggttaataaaactgagaaaat 484
|||||||||||||||||||||||
Sbjct: 469 cgggttaataaaactgagaaaat 491
>gb|AF133458.1|AF133458 Leersia virginica ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1209
Score = 46.1 bits (23), Expect = 0.036
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 460 cccgggttaataaaactgagaaa 482
|||||||||||||||||||||||
Sbjct: 453 cccgggttaataaaactgagaaa 475
>gb|AF083221.1|AF083221 Takifugu rubripes
Length = 43373
Score = 46.1 bits (23), Expect = 0.036
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 95 cacccccagtccaatggacaggcagaacgagctaa 129
|||||||||||||| || ||| |||||||||||||
Sbjct: 20488 cacccccagtccaacgggcagacagaacgagctaa 20522
>gb|AF095730.1|AF095730 Glycine max retroelement diaspora gag-pol polyprotein (gag-pol)
pseudogene, partial sequence
Length = 4152
Score = 46.1 bits (23), Expect = 0.036
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 95 cacccccagtccaatggacaggcagaa 121
||||||||| |||||||||||||||||
Sbjct: 3936 cacccccagaccaatggacaggcagaa 3962
>emb|AJ293846.1|KPN293846 Klebsiella pneumoniae transposon TN3926 partial tra7 gene for
transposase, contig region pSL007
Length = 748
Score = 46.1 bits (23), Expect = 0.036
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1 gcgtggtcgcggccgaggtacca 23
|||||||||||||||||||||||
Sbjct: 702 gcgtggtcgcggccgaggtacca 680
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcgaa 507
|||||||||||||||||||||
Sbjct: 50 ctgcccgggcggccgctcgaa 30
>emb|AJ276853.1|KPN276853 Klebsiella pneumoniae partial SL021 plasmid
Length = 450
Score = 46.1 bits (23), Expect = 0.036
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1 gcgtggtcgcggccgaggtacca 23
|||||||||||||||||||||||
Sbjct: 447 gcgtggtcgcggccgaggtacca 425
>dbj|AB019563.1|AB019563 Homo sapiens mRNA expressed only in placental villi, clone SMAP42
Length = 333
Score = 46.1 bits (23), Expect = 0.036
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1 gcgtggtcgcggccgaggtacca 23
|||||||||||||||||||||||
Sbjct: 332 gcgtggtcgcggccgaggtacca 310
Score = 38.2 bits (19), Expect = 8.7
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcg 505
|||||||||||||||||||
Sbjct: 19 ctgcccgggcggccgctcg 1
>gb|AF133491.1|AF133491 Joinvillea ascendens ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1229
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 463 gggttaataaaactgagaaaat 484
||||||||||||||||||||||
Sbjct: 458 gggttaataaaactgagaaaat 479
>gb|AF133490.1|AF133490 Streptochaeta angustifolia ribosomal protein 16 large subunit
(rpl16) gene, intron, chloroplast sequence
Length = 1243
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 463 gggttaataaaactgagaaaat 484
||||||||||||||||||||||
Sbjct: 496 gggttaataaaactgagaaaat 517
>gb|AF133488.1|AF133488 Pharus lappulaceus ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1182
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 463 gggttaataaaactgagaaaat 484
||||||||||||||||||||||
Sbjct: 437 gggttaataaaactgagaaaat 458
>gb|AF133486.1|AF133486 Molinia caerulea ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1211
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 463 gggttaataaaactgagaaaat 484
||||||||||||||||||||||
Sbjct: 483 gggttaataaaactgagaaaat 504
>gb|AF133484.1|AF133484 Phragmites australis ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1199
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 463 gggttaataaaactgagaaaat 484
||||||||||||||||||||||
Sbjct: 481 gggttaataaaactgagaaaat 502
>gb|AF133482.1|AF133482 Chasmanthium laxum ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1195
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 463 gggttaataaaactgagaaaat 484
||||||||||||||||||||||
Sbjct: 474 gggttaataaaactgagaaaat 495
>gb|AF133480.1|AF133480 Zoysia matrella ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1204
Score = 44.1 bits (22), Expect = 0.14
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
||||| ||||||||||||||||||||
Sbjct: 476 gcccgcgttaataaaactgagaaaat 501
>gb|AF133474.1|AF133474 Poa pratensis ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1097
Score = 44.1 bits (22), Expect = 0.14
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 455 agccgcccgggttaataaaactgagaaaat 484
||||| |||| |||||||||||||||||||
Sbjct: 482 agccgaccggattaataaaactgagaaaat 511
>gb|AF133464.1|AF133464 Lithachne pauciflora ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1189
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 463 gggttaataaaactgagaaaat 484
||||||||||||||||||||||
Sbjct: 468 gggttaataaaactgagaaaat 489
>gb|AF133460.1|AF133460 Streptogyna americana ribosomal protein 16 large subunit (rpl16)
gene, intron, chloroplast sequence
Length = 1228
Score = 44.1 bits (22), Expect = 0.14
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 459 gcccgggttaataaaactgagaaaat 484
|||||||||||||||||||| |||||
Sbjct: 471 gcccgggttaataaaactgataaaat 496
>emb|AJ315149.1|OMY315149 Oncorhynchus mykiss mRNA for CC chemokine
Length = 548
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1 gcgtggtcgcggccgaggtacc 22
||||||||||||||||||||||
Sbjct: 547 gcgtggtcgcggccgaggtacc 526
Score = 38.2 bits (19), Expect = 8.7
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcg 505
|||||||||||||||||||
Sbjct: 19 ctgcccgggcggccgctcg 1
>emb|AJ279850.1|MMU279850 Mus musculus partial mRNA for hypothetical protein, clone mvx2011
Length = 256
Score = 44.1 bits (22), Expect = 0.14
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 481 aaataactgcccgggcggccgctcga 506
||||| ||||||||||||||||||||
Sbjct: 231 aaatacctgcccgggcggccgctcga 256
>emb|AJ293847.1|KPN293847 Klebsiella pneumoniae contig region pSL015
Length = 700
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1 gcgtggtcgcggccgaggtacc 22
||||||||||||||||||||||
Sbjct: 421 gcgtggtcgcggccgaggtacc 400
>emb|AJ276850.1|KPN276850 Klebsiella pneumoniae partial SL017 plasmid
Length = 450
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1 gcgtggtcgcggccgaggtacc 22
||||||||||||||||||||||
Sbjct: 302 gcgtggtcgcggccgaggtacc 281
>gb|U26024.1|BTU26024 Bos taurus pigpen mRNA, complete cds
Length = 1779
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 485 aactgcccgggcggccgctcga 506
||||||||||||||||||||||
Sbjct: 22 aactgcccgggcggccgctcga 1
>gb|U54750.1|RPU54750 Rhipidocladum pittieri ribosomal protein L16 (rpl16) gene,
chloroplast gene encoding chloroplast protein, partial
intron
Length = 1010
Score = 44.1 bits (22), Expect = 0.14
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 463 gggttaataaaactgagaaaat 484
||||||||||||||||||||||
Sbjct: 451 gggttaataaaactgagaaaat 472
>gb|AF271776.1|AF271776 Homo sapiens DC48 mRNA, complete cds
Length = 1033
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1 gcgtggtcgcggccgaggtac 21
|||||||||||||||||||||
Sbjct: 864 gcgtggtcgcggccgaggtac 844
>gb|AF133478.1|AF133478 Sorghum bicolor ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1200
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 464 ggttaataaaactgagaaaat 484
|||||||||||||||||||||
Sbjct: 478 ggttaataaaactgagaaaat 498
>gb|AF133475.1|AF133475 Avena sativa ribosomal protein 16 large subunit (rpl16) gene,
intron, chloroplast sequence
Length = 1187
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 464 ggttaataaaactgagaaaat 484
|||||||||||||||||||||
Sbjct: 430 ggttaataaaactgagaaaat 450
>gb|AF151726.1|AF151726 Dianthus caryophyllus clone CFMI-6
Length = 553
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1 gcgtggtcgcggccgaggtac 21
|||||||||||||||||||||
Sbjct: 529 gcgtggtcgcggccgaggtac 509
>emb|AJ310908.1|FVE310908 Fucus vesiculosus mRNA for ALA dehydratase (hemB gene)
Length = 1530
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcgaa 507
|||||||||||||||||||||
Sbjct: 54 ctgcccgggcggccgctcgaa 34
>emb|AJ293850.1|KPN293850 Klebsiella pneumoniae partial EVGA gene for putative positive
transcription regulator EVGA, contig region pSL042
Length = 450
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcgtggtcgcggccgaggtac 21
|||||||||||||||||||||
Sbjct: 57 gcgtggtcgcggccgaggtac 77
>emb|AJ293849.1|KPN293849 Klebsiella pneumoniae contig region pSL029
Length = 720
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcgtggtcgcggccgaggtac 21
|||||||||||||||||||||
Sbjct: 20 gcgtggtcgcggccgaggtac 40
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 407 ctgcccgggcggccgctcga 426
>emb|AJ293848.1|KPN293848 Klebsiella pneumoniae contig region pSL022
Length = 739
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 487 ctgcccgggcggccgctcgaa 507
|||||||||||||||||||||
Sbjct: 719 ctgcccgggcggccgctcgaa 739
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcgtggtcgcggccgaggtac 21
|||||||||||||||||||||
Sbjct: 32 gcgtggtcgcggccgaggtac 52
>emb|AJ276849.1|KPN276849 Klebsiella pneumoniae partial SL016 plasmid
Length = 450
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 487 ctgcccgggcggccgctcgaa 507
|||||||||||||||||||||
Sbjct: 349 ctgcccgggcggccgctcgaa 369
>emb|AJ250102.1|OCU250102 Oryctolagus cuniculus partial mRNA for haptoglobin
Length = 647
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcgtggtcgcggccgaggtac 21
|||||||||||||||||||||
Sbjct: 3 gcgtggtcgcggccgaggtac 23
>emb|AJ276856.1|KPN276856 Klebsiella pneumoniae partial SL038 plasmid
Length = 450
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1 gcgtggtcgcggccgaggtac 21
|||||||||||||||||||||
Sbjct: 425 gcgtggtcgcggccgaggtac 405
>dbj|AP003595.1|AP003595 Nostoc sp. PCC 7120 DNA, complete genome, section 15/19
Length = 347550
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 466 ttaataaaactgagaaaataa 486
|||||||||||||||||||||
Sbjct: 62570 ttaataaaactgagaaaataa 62550
>emb|AJ001134.1|SRMETPANS Strongyloides ratti mRNA for metallopanstimulin
Length = 448
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcgaa 507
|||||||||||||||||||||
Sbjct: 88 ctgcccgggcggccgctcgaa 68
>dbj|AB047592.1|AB047592 Trichophyton mentagrophytes mRNA for alpha-crystallin-related
protein, complete cds
Length = 457
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcgaa 507
|||||||||||||||||||||
Sbjct: 25 ctgcccgggcggccgctcgaa 5
>dbj|AB019571.1|AB019571 Homo sapiens mRNA expressed only in placental villi, clone SMAP5
Length = 1042
Score = 42.1 bits (21), Expect = 0.56
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcgtggtcgcggccgaggtac 21
|||||||||||||||||||||
Sbjct: 2 gcgtggtcgcggccgaggtac 22
>ref|NM_139017.1| Homo sapiens similar to CRL3 protein (CRL3), mRNA
Length = 1761
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 35 ctgcccgggcggccgctcga 16
>gb|AF097021.1| Homo sapiens
Length = 2861
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 20 ctgcccgggcggccgctcga 1
>ref|NM_130806.2| Homo sapiens similar to G protein coupled receptor affecting
testicular descent (H. sapiens) (GREAT), mRNA
Length = 2838
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 34 ctgcccgggcggccgctcga 15
>gb|AF022770.2| Mus musculus strain BALB/c
Length = 1543
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 48 ctgcccgggcggccgctcga 29
>ref|NM_007227.2| Homo sapiens G protein-coupled receptor 45 (GPR45), mRNA
Length = 1777
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 38 ctgcccgggcggccgctcga 19
>gb|AC009957.11| Homo sapiens BAC clone RP11-285H23 from 2, complete sequence
Length = 191119
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 88 agtggcacacccccagtcca 107
||||||||||||||||||||
Sbjct: 168251 agtggcacacccccagtcca 168270
>gb|AF403384.2| Homo sapiens chromosome 11 map 11q13
Length = 2838
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 34 ctgcccgggcggccgctcga 15
>gb|AF075584.1|TGFA2 Homo sapiens transforming growth factor alpha precursor (TGFA)
gene, exon 2 and partial cds
Length = 758
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 31 ctgcccgggcggccgctcga 12
>gb|AF075583.1|TGFA1 Homo sapiens transforming growth factor alpha precursor (TGFA)
gene, exon 1
Length = 284
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 249 ctgcccgggcggccgctcga 268
>gb|AF106913.1|AF106913 Homo sapiens CRL3 protein (CRL3) mRNA, complete cds
Length = 1761
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 35 ctgcccgggcggccgctcga 16
>gb|AF039086.1|AF039086 Pseudomicrothorax dubius articulin 1 mRNA, complete cds
Length = 2084
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 20 ctgcccgggcggccgctcga 1
>gb|AF107491.1|AF107491 Hexamita sp.
Length = 1059
Score = 40.1 bits (20), Expect = 2.2
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 487 ctgcccgggcggccgctcga 506
||||||||||||||||||||
Sbjct: 1034 ctgcccgggcggccgctcga 1053
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
Posted date: May 13, 2002 3:54 AM
Number of letters in database: 1,205,879,881
Number of sequences in database: 1,217,082
Lambda K H
1.37 0.711 0.00
Gapped
Lambda K H
1.37 0.711 4.94e-324
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,030,074
Number of Sequences: 1217082
Number of extensions: 1030074
Number of successful extensions: 17532
Number of sequences better than 10.0: 275
length of query: 507
length of database: 5,500,847,177
effective HSP length: 21
effective length of query: 486
effective length of database: 5,475,288,455
effective search space: 2660990189130
effective search space used: 2660990189130
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)