The query sequence for this search has been filtered. Filtering
eliminates low complexity regions that commonly give spuriously high
scores that reflect compositional bias rather than significant
position-by-position alignment. Filtering can eliminate these potentially
confounding matches (e.g., hits against proline-rich regions or poly-A
tails) from the blast reports, leaving regions whose blast statistics
reflect the specificity of their pairwise alignment.

BLASTN 2.2.3 [Apr-24-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Fgr-S3_1_D05_T7.seq Fgr-S3_1_D05_T7 LENGTH:641bp ;
DIRECTION:5 ; CLONE:Fgr-S3_1_D05 ; CLONELIB: n/a 
         (641 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
           1,217,082 sequences; 1,205,879,881 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AF120169.1|AF120169  Aegilops longissima RAPD-generated m...    72   8e-10
emb|AL451052.4|AL451052  Human DNA sequence from clone RP11-...    40   2.8  
gb|AC007743.3|AC007743  Homo sapiens chromosome 2 clone RP11...    40   2.8  
gb|AF065630.1|GGOTC1  Gallus gallus ornithine transcarbamyla...    40   2.8  
emb|X57904.1|OS08RG36F  O.sativa random single-copy DNA frag...    40   2.8  

>gb|AF120169.1|AF120169 Aegilops longissima RAPD-generated marker sequence amplified with
           OPI07
          Length = 782

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 161/200 (80%), Gaps = 2/200 (1%)
 Strand = Plus / Minus

                                                                       
Query: 442 ttcaaaatgacatcgagtctctgatgactcgactcaataaggatcctggtcgagtgcagg 501
           ||||||||||| ||||||||||||||||| | || ||| | | ||| ||||||||||| |
Sbjct: 416 ttcaaaatgacctcgagtctctgatgacttggctgaatgacgttccaggtcgagtgcaag 357

                                                                       
Query: 502 aatggaataaagtcttctgcctgatacggagctgacgtggctctgtcgctggttagggtc 561
           ||||||| ||||||||| ||| | |  || |||||||| ||||| || |||||  | || 
Sbjct: 356 aatggaa-aaagtcttccgccaggtgtggtgctgacgttgctctatccctggtctgtgtt 298

                                                                       
Query: 562 cactgcaaagaagcttgagaagagaagctagcagcgc-tcaaggttgccaataccaaaag 620
           |||||||| || ||  |||| || ||||| ||  | | |||| || ||||||||||| | 
Sbjct: 297 cactgcaaggacgcgcgagaggacaagctggcgtcccatcaaagtggccaataccaagaa 238

                               
Query: 621 gcatgacttccaatccttca 640
           ||||||||||||||| ||||
Sbjct: 237 gcatgacttccaatctttca 218



>emb|AL451052.4|AL451052 Human DNA sequence from clone RP11-24P14 on chromosome 1, complete
             sequence [Homo sapiens]
          Length = 109864

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 115   ctggaagcttatctgaaagc 134
             ||||||||||||||||||||
Sbjct: 19114 ctggaagcttatctgaaagc 19095



>gb|AC007743.3|AC007743 Homo sapiens chromosome 2 clone RP11-481J13 map 2, complete sequence
          Length = 141836

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 565   tgcaaagaagcttgagaagagaag 588
             ||||||||||||||| ||||||||
Sbjct: 24203 tgcaaagaagcttgaaaagagaag 24180



>gb|AF065630.1|GGOTC1 Gallus gallus ornithine transcarbamylase (OTC) gene, exon 1
          Length = 1903

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 238  atctgtagaattcgaccaaa 257
            ||||||||||||||||||||
Sbjct: 1357 atctgtagaattcgaccaaa 1376



>emb|X57904.1|OS08RG36F O.sativa random single-copy DNA fragment 08RG365F
          Length = 239

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 569 aagaagcttgagaagagaag 588
           ||||||||||||||||||||
Sbjct: 147 aagaagcttgagaagagaag 166



  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
  or phase 0, 1 or 2 HTGS sequences)
    Posted date:  May 13, 2002  3:54 AM
  Number of letters in database: 1,205,879,881
  Number of sequences in database:  1,217,082
  
Lambda     K      H
    1.37    0.711     0.00 

Gapped
Lambda     K      H
    1.37    0.711 4.94e-324 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,547,446
Number of Sequences: 1217082
Number of extensions: 1547446
Number of successful extensions: 26997
Number of sequences better than 10.0: 5
length of query: 641
length of database: 5,500,847,177
effective HSP length: 21
effective length of query: 620
effective length of database: 5,475,288,455
effective search space: 3394678842100
effective search space used: 3394678842100
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)