The query sequence for this search has been filtered. Filtering
eliminates low complexity regions that commonly give spuriously high
scores that reflect compositional bias rather than significant
position-by-position alignment. Filtering can eliminate these potentially
confounding matches (e.g., hits against proline-rich regions or poly-A
tails) from the blast reports, leaving regions whose blast statistics
reflect the specificity of their pairwise alignment.

BLASTN 2.2.3 [Apr-24-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Fgr-S3_1_E18_T7.seq Fgr-S3_1_E18_T7 LENGTH:86bp ;
DIRECTION:5 ; CLONE:Fgr-S3_1_E18 ; CLONELIB: n/a ;
         (86 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
           1,217,082 sequences; 1,205,879,881 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AF373281.1|AF373281  Nalanthamala squamicola large subuni...    82   9e-14
gb|AF279400.1|AF279400  Mycopepon smithii large subunit ribo...    82   9e-14
gb|AF213026.1|AF213026  Cladobotryum gracile 28S ribosomal R...    82   9e-14
gb|AF213025.1|AF213025  Cladobotryum apiculatum 28S ribosoma...    82   9e-14
gb|AF160246.1|AF160246  Sphaerostilbella aureonitens 28S rib...    82   9e-14
gb|AF160242.1|AF160242  Hypomyces rosellus 28S ribosomal RNA...    82   9e-14
gb|AF160240.1|AF160240  Hypomyces odoratus 28S ribosomal RNA...    82   9e-14
gb|AF160239.1|AF160239  Hypomyces armeniacus 28S ribosomal R...    82   9e-14
gb|AF160230.1|AF160230  Hypomyces aurantius 28S ribosomal RN...    82   9e-14
gb|AF160228.1|AF160228  Cladobotryum rubrobrunnescens 28S ri...    82   9e-14
gb|AF019200.1|AF019200  Gliocladium catenulatum 28S ribosoma...    82   9e-14
gb|AF009184.1|AF009184  Fusarium oxysporum 28S ribosomal RNA...    82   9e-14
gb|AF009183.1|AF009183  Fusarium tricinctum 28S ribosomal RN...    82   9e-14
gb|AF009182.1|AF009182  Fusarium redolens 28S ribosomal RNA ...    82   9e-14
gb|AF160235.1|AF160235  Sporophagomyces chrysostomus isolate...    80   4e-13
gb|AF160234.1|AF160234  Sporophagomyces chrysostomus isolate...    80   4e-13
dbj|AB073534.1|AB073534  Xylaria sp. KU416 gene for 28S rRNA...    80   4e-13
gb|AF373280.1|AF373280  Ustilaginoidea sp. IB9228 large subu...    78   1e-12
gb|AF389190.1|AF389190  Chaunopycnis pustulata 28S ribosomal...    74   2e-11
gb|AF373285.1|AF373285  Cordyceps subsessilis large subunit ...    74   2e-11
gb|AF373284.1|AF373284  Chaunopycnis alba large subunit ribo...    74   2e-11
gb|AF373283.1|AF373283  Chaunopycnis pustalata clone MF5785L...    74   2e-11
gb|AF373282.1|AF373282  Chaunopycnis pustulata clone MF5368L...    74   2e-11
gb|AF279395.1|AF279395  Hypocrea schweinitzii large subunit ...    74   2e-11
gb|AF213032.1|AF213032  Verticillium cf. fungicola 28S ribos...    74   2e-11
gb|AF213031.1|AF213031  Mycogone rosea 28S ribosomal RNA gen...    74   2e-11
gb|AF213030.1|AF213030  Mycogone calospora 28S ribosomal RNA...    74   2e-11
gb|AF160245.1|AF160245  Hypomyces sympodiophorus isolate CBS...    74   2e-11
gb|AF160244.1|AF160244  Hypomyces sympodiophorus isolate G.J...    74   2e-11
gb|AF160241.1|AF160241  Hypomyces orthosporus 28S ribosomal ...    74   2e-11
gb|AF160238.1|AF160238  Hypomyces mycophilus 28S ribosomal R...    74   2e-11
gb|AF160237.1|AF160237  Hypomyces luteovirens 28S ribosomal ...    74   2e-11
gb|AF160231.1|AF160231  Sphaerostilbella broomeana 28S ribos...    74   2e-11
gb|AF160229.1|AF160229  Cladobotryum stereicola 28S ribosoma...    74   2e-11
gb|AF213028.1|AF213028  Hypomyces completus 28S ribosomal RN...    74   2e-11
gb|AF019201.1|AF019201  Trichoderma virens 28S ribosomal RNA...    74   2e-11
gb|AF431949.1|  Cainia graminis strain CBS 136.62 28S riboso...    72   9e-11
gb|AF279410.1|AF279410  Seynesia erumpens large subunit ribo...    72   9e-11
gb|AF373286.1|AF373286  Tolypocladium inflatum large subunit...    70   3e-10
gb|AF160236.1|AF160236  Hypomyces lateritius 28S ribosomal R...    70   3e-10
gb|AF104926.1|AF104926  Verticillium dahliae 18S ribosomal R...    66   5e-09
gb|AF396876.1|AF396876  Halosarpheia unicellularis large sub...    66   5e-09
gb|AF327388.1|AF327388  Torrubiella luteorostrata strain 269...    66   5e-09
gb|AF327384.1|AF327384  Cordyceps tuberculata 28S ribosomal ...    66   5e-09
gb|AF327381.1|AF327381  Hypocrella discoidea strain 4093 28S...    66   5e-09
gb|AF327376.1|AF327376  Cordyceps pseudomilitaris 28S riboso...    66   5e-09
gb|AF327374.1|AF327374  Cordyceps militaris 28S ribosomal RN...    66   5e-09
gb|AF213027.1|AF213027  Hypomyces chlorinigenus 28S ribosoma...    66   5e-09
emb|Z49794.1|CB26RRNA2  C.bifusispora gene for 26S ribosomal...    66   5e-09
gb|AF279374.1|AF279374  Aniptodera chesapeakensis large subu...    64   2e-08
gb|AF213029.1|AF213029  Hypomyces corticiicola 28S ribosomal...    64   2e-08
gb|AF327387.1|AF327387  Hypocrella discoidea strain 2630 28S...    62   8e-08
gb|AF160243.1|AF160243  Hypomyces stephanomatis 28S ribosoma...    62   8e-08
gb|AF431950.1|  Cephalotheca sulfurea strain CBS 135.34 28S ...    58   1e-06
gb|AF113137.1|AF113137  Eremothecium gossypii 5S ribosomal R...    58   1e-06
gb|AF327390.1|AF327390  Cordyceps sphecocephala strain 4169 ...    58   1e-06
gb|AF327389.1|AF327389  Cordyceps irangiensis strain 3450 28...    58   1e-06
gb|AF327386.1|AF327386  Aschersonia badia 28S ribosomal RNA ...    58   1e-06
gb|AF327385.1|AF327385  Akanthomyces arachnophilus 28S ribos...    58   1e-06
gb|AF327383.1|AF327383  Akanthomyces novoguineensis 28S ribo...    58   1e-06
gb|AF327382.1|AF327382  Cordyceps cylindrica strain 3076 28S...    58   1e-06
gb|AF327379.1|AF327379  Cordyceps sphecocephala strain 4018 ...    58   1e-06
gb|AF327378.1|AF327378  Cordyceps irangiensis strain 3938 28...    58   1e-06
gb|AF327377.1|AF327377  Cordyceps cylindrica strain 2347 28S...    58   1e-06
gb|AF178565.1|AF178565  Chaetosphaeria aterrima 28S ribosoma...    58   1e-06
gb|AF178560.1|AF178560  Cylindrotrichum hennebertii internal...    58   1e-06
gb|AF178547.1|AF178547  Chaetosphaeria tulasneorum internal ...    58   1e-06
gb|AF218207.1|AF218207  Metarhizium anisopliae small subunit...    58   1e-06
gb|AF362557.1|AF362557  Gaeumannomyces graminis var. gramini...    56   5e-06
gb|AF362556.1|AF362556  Gaeumannomyces graminis var. avenae ...    56   5e-06
gb|AF362554.1|AF362554  Magnaporthe grisea isolate AR3390 28...    56   5e-06
gb|AF178564.1|AF178564  Chaetosphaeria inaequalis internal t...    56   5e-06
gb|AF178563.1|AF178563  Porosphaerella cordanophora internal...    56   5e-06
gb|AF178550.1|AF178550  Chaetosphaeria vermicularioides inte...    56   5e-06
dbj|AB026819.1|AB026819  Magnaporthe grisea genes for 18S rR...    56   5e-06
emb|Z49789.1|CG26RRNA2  C.globosum gene for 26S ribosomal RNA      56   5e-06
gb|AF431951.1|  Sclerotinia sclerotiorum strain CBS 499.50 2...    54   2e-05
gb|AY038325.1|  Inocybe sp. Trappe 25080 25S large subunit r...    54   2e-05
gb|AF310101.1|  Gloeocystidiellum porosum strain FCUG2734 5....    54   2e-05
gb|AF310100.1|  Gloeocystidiellum porosum strain FCUG2768 5....    54   2e-05
gb|AF310099.1|  Gloeocystidiellum porosum strain FCUG2661 5....    54   2e-05
gb|AF310098.1|  Gloeocystidiellum porosum specimen-voucher C...    54   2e-05
gb|AF310097.1|  Gloeocystidiellum porosum specimen-voucher C...    54   2e-05
gb|AF310096.1|  Gloeocystidiellum porosum strain FCUG2412 5....    54   2e-05
gb|AF310093.1|  Gloeocystidiellum porosum strain FCUG2435 5....    54   2e-05
gb|AF310090.1|  Gloeocystidiellum sp. NH12972 strain FCUG267...    54   2e-05
gb|AF310089.1|  Gloeocystidiellum sp. NH13258 strain FCUG276...    54   2e-05
gb|AF310087.1|  Gloeocystidiellum clavuligerum strain FCUG10...    54   2e-05
gb|AF310085.1|  Gloeocystidiellum clavuligerum specimen-vouc...    54   2e-05
gb|AF310084.1|  Gloeocystidiellum clavuligerum specimen-vouc...    54   2e-05
gb|AF310083.1|  Gloeocystidiellum clavuligerum strain FCUG27...    54   2e-05
gb|AF310078.1|  Gloeocystidiellum clavuligerum strain FCUG67...    54   2e-05
gb|AF310077.1|  Gloeocystidiellum clavuligerum strain FCUG67...    54   2e-05
gb|AF378367.1|AF378367  Peziza vesiculosa large subunit ribo...    54   2e-05
gb|AY016360.1|  Dothidea ribesia 28S ribosomal RNA gene, par...    54   2e-05
gb|AY016359.1|  Discosphaerina fagi 28S ribosomal RNA gene, ...    54   2e-05
gb|AY016358.1|  Delphinella strobiligena 28S ribosomal RNA g...    54   2e-05
gb|AF381555.1|AF381555  Melanaria sp. Printzen 1998 28S ribo...    54   2e-05
gb|AF356652.1|AF356652  Filobasidiella neoformans var. neofo...    54   2e-05
gb|AF327391.1|AF327391  Torrubiella arachnophilus 28S riboso...    54   2e-05
gb|AY012676.1|  Hydnellum gracilipes large subunit ribosomal...    54   2e-05
gb|AF279401.1|AF279401  Neolecta irregularis large subunit r...    54   2e-05
gb|AF279385.1|AF279385  Dibaeis baeomyces large subunit ribo...    54   2e-05
gb|AY004345.1|  Eremascus albus 28S large subunit ribosomal ...    54   2e-05
gb|AY004342.1|  Stylodothis puccinioides 28S large subunit r...    54   2e-05
gb|AY004334.1|  Lophodermium pinastri 28S large subunit ribo...    54   2e-05
gb|AF279296.1|AF279296  Pertusaria lecanina 28S large subuni...    54   2e-05
gb|AF090882.1|AF090882  Ceraceomyces serpens isolate KHL8478...    54   2e-05
gb|AF090881.1|AF090881  Ceraceomyces eludens isolate JS20378...    54   2e-05
gb|AF090880.1|AF090880  Ceraceomyces eludens isolate JS24145...    54   2e-05
gb|AF090879.1|AF090879  Ceraceomyces eludens isolate JS27108...    54   2e-05
gb|AF090878.1|AF090878  Ceraceomyces eludens isolate JS27202...    54   2e-05
gb|AF090877.1|AF090877  Ceraceomyces eludens isolate JS22780...    54   2e-05
gb|AF090876.1|AF090876  Ceraceomyces microsporus isolate JS2...    54   2e-05
gb|AF090874.1|AF090874  Ceraceomyces microsporus isolate JS2...    54   2e-05
gb|AF090873.1|AF090873  Ceraceomyces microsporus isolate JS2...    54   2e-05
gb|U66437.1|RPU66437  Rickenella pseudogrisella small subuni...    54   2e-05
gb|AF003359.1|PEAF003359  Penicillium expansum 28S large sub...    54   2e-05
gb|AF003358.1|PVAF003358  Penicillium viridicatum 28S large ...    54   2e-05
gb|AF003357.1|PVAF003357  Penicillium verrucosum 28S large s...    54   2e-05
gb|AF003355.1|PAAF003355  Penicillium aurantiogriseum 28S la...    54   2e-05
gb|U66438.1|RMU66438  Rickenella mellea small subunit riboso...    54   2e-05
gb|U66452.1|ORU66452  Omphalina rosella small subunit riboso...    54   2e-05
emb|AL114059.1|CNS01BCJ  Botrytis cinerea strain T4 cDNA lib...    54   2e-05
emb|AL113346.1|CNS01ASQ  Botrytis cinerea strain T4 cDNA lib...    54   2e-05
emb|AL112603.1|CNS01A83  Botrytis cinerea strain T4 cDNA lib...    54   2e-05
dbj|AB073542.1|AB073542  Termitomyces sp. Group5 gene for 28...    54   2e-05
dbj|AB073541.1|AB073541  Termitomyces sp. Group5 gene for 28...    54   2e-05
dbj|AB073540.1|AB073540  Termitomyces sp. Group4 gene for 28...    54   2e-05
dbj|AB073539.1|AB073539  Termitomyces sp. Group4 gene for 28...    54   2e-05
dbj|AB073527.1|AB073527  Termitomyces sp. Group4 genes for 1...    54   2e-05
dbj|AB073526.1|AB073526  Termitomyces sp. Group4 genes for 1...    54   2e-05
emb|Z48320.1|UHRNA26SB  U.hiemalis partial gene for 26S ribo...    54   2e-05
emb|Z49793.1|TP26RRNA2  T.pruni gene for 26S ribosomal RNA         54   2e-05
emb|Z48318.1|NVRNA26SB  N.vitellina partial gene for 26S rib...    54   2e-05
emb|Z48316.1|NIRNA26SB  N.irregularis partial gene for 26S r...    54   2e-05
gb|L14067.1|CPC5825S  Cryptococcus neoformans 5.8S and 25S r...    54   2e-05
gb|L14068.1|CPC5825  Cryptococcus neoformans 5.8S and 25S ri...    54   2e-05
emb|X78778.1|GTJ225S  G.tsugae gene for 25S ribosomal RNA          54   2e-05
emb|X78779.1|GM25S9  G.microsporum gene for 25S ribosomal RNA      54   2e-05
emb|X78776.1|GLRZ25S  G.lucidum gene for 25S ribosomal RNA         54   2e-05
emb|X78777.1|GBRS25S  G.boninense gene for 25S ribosomal RNA       54   2e-05
emb|X78780.1|GA25S0  G.australe gene for 25S ribosomal RNA         54   2e-05
gb|AY026375.1|  Montastraea franksi 28S large subunit riboso...    52   8e-05
gb|AY026365.1|  Antipathes galapagensis 28S large subunit ri...    52   8e-05
gb|AY016369.1|  Trematosphaeria heterospora 28S ribosomal RN...    52   8e-05
gb|AY016363.1|  Lojkania enalia 28S ribosomal RNA gene, part...    52   8e-05
gb|AY016362.1|  Letendraea helminthicola 28S ribosomal RNA g...    52   8e-05
gb|AY016361.1|  Kirschsteiniothelia aethiops 28S ribosomal R...    52   8e-05
gb|AY016357.1|  Byssothecium circinans 28S ribosomal RNA gen...    52   8e-05
gb|AF327380.1|AF327380  Torrubiella luteorostrata strain 555...    52   8e-05
gb|AF327375.1|AF327375  Cordyceps khaoyaiensis 28S ribosomal...    52   8e-05
gb|AY004343.1|  Westerdykella cylindrica 28S large subunit r...    52   8e-05
gb|AY004341.1|  Pleomassaria siparia 28S large subunit ribos...    52   8e-05
gb|AF310082.1|  Gloeocystidiellum clavuligerum strain FCUG25...    50   3e-04
gb|AY064705.1|  Pezicula alba strain CBS109875 28S ribosomal...    50   3e-04
gb|AF356658.1|AF356658  Baeomyces placophyllus large subunit...    50   3e-04
gb|AF279411.1|AF279411  Spathularia velutipes large subunit ...    50   3e-04
gb|AF279379.1|AF279379  Cudonia circinans large subunit ribo...    50   3e-04
gb|AY004335.1|  Tryblidiopsis pinastri 28S large subunit rib...    50   3e-04
gb|U53879.1|YSCL9634  Saccharomyces cerevisiae chromosome XI...    50   3e-04
gb|J01355.1|YSCRGIH5  S.cerevisiae 25S rRNA gene and flanks        50   3e-04
emb|AJ271061.1|MRA271061  Mucor racemosus 18S rRNA gene, 5.8...    50   3e-04
dbj|AB081118.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    50   3e-04
emb|Z73326.1|SCYLR154C  S.cerevisiae chromosome XII reading ...    50   3e-04
emb|Y08533.1|KL26SRRNA  K.lactis 26S ribosomal RNA                 50   3e-04
gb|M26190.1|MRARRHA  M.racemosus (Zygomycetes) 25S ribosomal...    50   3e-04
gb|AF396874.1|AF396874  Halosarpheia retorquens large subuni...    48   0.001
gb|AF090875.1|AF090875  Ceraceomyces microsporus isolate KHL...    48   0.001
gb|AF367963.1|  Pleuroflammula sp. OKM 27686 25S ribosomal R...    46   0.005
gb|AY038329.1|  Phaeomarasmius curcuma 25S large subunit rib...    46   0.005
gb|AY038328.1|  Inocybe stellatospora 25S large subunit ribo...    46   0.005
gb|AY038327.1|  Inocybe sp. PBM 1615 25S large subunit ribos...    46   0.005
gb|AY038326.1|  Inocybe sp. BK 8-Feb-99-1 25S large subunit ...    46   0.005
gb|AY038324.1|  Inocybe relicina 25S large subunit ribosomal...    46   0.005
gb|AY038323.1|  Inocybe pudica 25S large subunit ribosomal R...    46   0.005
gb|AY038322.1|  Inocybe praetervisa 25S large subunit riboso...    46   0.005
gb|AY038321.1|  Inocybe maculata 25S large subunit ribosomal...    46   0.005
gb|AY038320.1|  Inocybe leptophylla 25S large subunit riboso...    46   0.005
gb|AY038319.1|  Inocybe lanuginosa 25S large subunit ribosom...    46   0.005
gb|AY038318.1|  Inocybe lacera 25S large subunit ribosomal R...    46   0.005
gb|AY038317.1|  Inocybe hirsuta var. maxima 25S large subuni...    46   0.005
gb|AY038316.1|  Inocybe godeyi 25S large subunit ribosomal R...    46   0.005
gb|AY038315.1|  Inocybe dulcamara 25S large subunit ribosoma...    46   0.005
gb|AY038314.1|  Inocybe corydalina 25S large subunit ribosom...    46   0.005
gb|AY038313.1|  Inocybe calospora 25S large subunit ribosoma...    46   0.005
gb|AY038312.1|  Inocybe agglutinata 25S large subunit riboso...    46   0.005
gb|AY038311.1|  Inocybe abietis 25S large subunit ribosomal ...    46   0.005
gb|AY038310.1|  Hebeloma olympianum 25S large subunit riboso...    46   0.005
gb|AF261467.1|  Xeromphalina kauffmanii 25S large subunit ri...    46   0.005
gb|AF465448.1|  Phaeographina chrysocarpa large subunit ribo...    46   0.005
gb|AF310102.1|  Laxitextum bicolor strain FCUG2719 5.8S ribo...    46   0.005
gb|AF310088.1|  Gloeocystidiellum clavuligerum strain FCUG21...    46   0.005
gb|AF261580.1|AF261580  Pluteus umbrosus strain DAOM197235 l...    46   0.005
gb|AF261579.1|AF261579  Pluteus aurantiorugosus strain DAOM1...    46   0.005
gb|AF346420.1|AF346420  Glyphium elatum 28S large subunit ri...    46   0.005
gb|AY062120.1|  Trichophyton interdigitale 5.8S ribosomal RN...    46   0.005
gb|AY026372.1|  Leucosolenia sp. MMM-2001 28S large subunit ...    46   0.005
gb|AY016368.1|  Setosphaeria monoceras 28S ribosomal RNA gen...    46   0.005
gb|AY016365.1|  Myriangium duriaei 28S ribosomal RNA gene, p...    46   0.005
gb|AF396873.1|AF396873  Halosarpheia lotica large subunit ri...    46   0.005
gb|AF356679.1|AF356679  Thamnolia subuliformis large subunit...    46   0.005
gb|AF356678.1|AF356678  Rhizocarpon disporum large subunit r...    46   0.005
gb|AF356665.1|AF356665  Lasallia pennsylvanica large subunit...    46   0.005
gb|AF329176.1|AF329176  Pertusaria albescens 28S large subun...    46   0.005
gb|AF279407.1|AF279407  Pyrenula cruenta large subunit ribos...    46   0.005
gb|AF279398.1|AF279398  Morchella esculenta large subunit ri...    46   0.005
gb|AF279377.1|AF279377  Athelia bombacina large subunit ribo...    46   0.005
gb|AY004346.1|  Eurotium rubrum 28S large subunit ribosomal ...    46   0.005
gb|U62964.1|TMU62964  Tricholoma matsutake internal transcri...    46   0.005
gb|AF285782.1|AF285782  Sagenoma viride 18S ribosomal RNA ge...    46   0.005
gb|AF135795.1|AF135795  Gymnopus fusipes 28S ribosomal RNA g...    46   0.005
emb|AJ293849.1|KPN293849  Klebsiella pneumoniae contig regio...    46   0.005
gb|U86438.1|MTLSURRNA2  Macrocybe titans large subunit ribos...    46   0.005
gb|U86672.1|TSU86672  Tricholoma sp. 'TJV 94-134' large-subu...    46   0.005
gb|U66436.1|PGU66436  Phaeotellus griseopallidus small subun...    46   0.005
gb|U66456.1|OVU66456  Omphalina viridis small subunit riboso...    46   0.005
gb|U66455.1|OVU66455  Omphalina velutipes small subunit ribo...    46   0.005
gb|U66453.1|OSU66453  Omphalina sphagnicola small subunit ri...    46   0.005
gb|U66451.1|ORU66451  Omphalina rivulicola small subunit rib...    46   0.005
gb|U66449.1|OPU66449  Omphalina philonotis small subunit rib...    46   0.005
gb|U66448.1|OOU66448  Omphalina obscurata small subunit ribo...    46   0.005
gb|U66447.1|OLU66447  Omphalina luteovitellina small subunit...    46   0.005
gb|U66446.1|OHU66446  Omphalina hudsoniana small subunit rib...    46   0.005
gb|U66445.1|OEU66445  Omphalina ericetorum small subunit rib...    46   0.005
gb|U66441.1|OBU66441  Omphalina brevibasidiata small subunit...    46   0.005
gb|U66435.1|HCU66435  Hygrocybe citrinopallida small subunit...    46   0.005
gb|U66432.1|GMU66432  Gerronema marchantiae small subunit ri...    46   0.005
gb|U66429.1|ALU66429  Arrhenia lobata small subunit ribosoma...    46   0.005
gb|U66428.1|AAU66428  Arrhenia auriscalpium small subunit ri...    46   0.005
dbj|AB081119.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081117.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081116.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081115.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081114.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081113.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081112.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081110.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081109.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081108.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081107.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081106.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081105.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081104.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081103.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081102.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081101.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081100.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081099.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
dbj|AB081098.1|  Uncultured Termitomyces DNA, ITS1, 5.8S rRN...    46   0.005
>gb|AF373281.1|AF373281 Nalanthamala squamicola large subunit ribosomal RNA gene, partial
            sequence
          Length = 1202

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1144 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1092
>gb|AF279400.1|AF279400 Mycopepon smithii large subunit ribosomal RNA gene, partial sequence
          Length = 1220

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1093 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1041
>gb|AF213026.1|AF213026 Cladobotryum gracile 28S ribosomal RNA gene, partial sequence
          Length = 1156

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1115 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1063
>gb|AF213025.1|AF213025 Cladobotryum apiculatum 28S ribosomal RNA gene, partial sequence
          Length = 1342

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1120 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1068
>gb|AF160246.1|AF160246 Sphaerostilbella aureonitens 28S ribosomal RNA gene, partial sequence
          Length = 1344

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1121 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1069
>gb|AF160242.1|AF160242 Hypomyces rosellus 28S ribosomal RNA gene, partial sequence
          Length = 1344

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1121 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1069
>gb|AF160240.1|AF160240 Hypomyces odoratus 28S ribosomal RNA gene, partial sequence
          Length = 1233

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1117 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1065
>gb|AF160239.1|AF160239 Hypomyces armeniacus 28S ribosomal RNA gene, partial sequence
          Length = 1344

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1121 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1069
>gb|AF160230.1|AF160230 Hypomyces aurantius 28S ribosomal RNA gene, partial sequence
          Length = 1344

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1121 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1069
>gb|AF160228.1|AF160228 Cladobotryum rubrobrunnescens 28S ribosomal RNA gene, partial
            sequence
          Length = 1340

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1121 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1069
>gb|AF019200.1|AF019200 Gliocladium catenulatum 28S ribosomal RNA gene, partial sequence
          Length = 410

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 18  gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
           |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 201 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 149
>gb|AF009184.1|AF009184 Fusarium oxysporum 28S ribosomal RNA gene, partial sequence
          Length = 378

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 18  gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
           |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 183 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 131
>gb|AF009183.1|AF009183 Fusarium tricinctum 28S ribosomal RNA gene, partial sequence
          Length = 410

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 18  gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
           |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 215 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 163
>gb|AF009182.1|AF009182 Fusarium redolens 28S ribosomal RNA gene, partial sequence
          Length = 378

 Score = 81.8 bits (41), Expect = 9e-14
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 18  gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
           |||||||||||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 183 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacct 131
>gb|AF160235.1|AF160235 Sporophagomyces chrysostomus isolate TFC 96-193 28S ribosomal RNA
            gene, partial sequence
          Length = 1234

 Score = 79.8 bits (40), Expect = 4e-13
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            |||||||||||||||| || ||||||||| ||||||||||||||||||||||
Sbjct: 1124 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacc 1073
>gb|AF160234.1|AF160234 Sporophagomyces chrysostomus isolate TFC 96-192 28S ribosomal RNA
            gene, partial sequence
          Length = 1235

 Score = 79.8 bits (40), Expect = 4e-13
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            |||||||||||||||| || ||||||||| ||||||||||||||||||||||
Sbjct: 1124 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacc 1073
>dbj|AB073534.1|AB073534 Xylaria sp. KU416 gene for 28S rRNA, partial sequence, strain:KU416
          Length = 1310

 Score = 79.8 bits (40), Expect = 4e-13
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            |||||||||||||||| || ||||||||| ||||||||||||||||||||||
Sbjct: 1201 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaacc 1150
>gb|AF373280.1|AF373280 Ustilaginoidea sp. IB9228 large subunit ribosomal RNA gene, partial
            sequence
          Length = 1341

 Score = 77.8 bits (39), Expect = 1e-12
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                               
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaac 68
            |||||||||||||||| || ||||||||| |||||||||||||||||||||
Sbjct: 1161 gtactaacaccttttgtggtgtctgatgagcgtctactctggcaccttaac 1111
>gb|AF389190.1|AF389190 Chaunopycnis pustulata 28S ribosomal RNA gene, partial sequence
          Length = 1243

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1124 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1072
>gb|AF373285.1|AF373285 Cordyceps subsessilis large subunit ribosomal RNA gene, partial
            sequence
          Length = 1178

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1143 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1091
>gb|AF373284.1|AF373284 Chaunopycnis alba large subunit ribosomal RNA gene, partial sequence
          Length = 1163

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1127 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1075
>gb|AF373283.1|AF373283 Chaunopycnis pustalata clone MF5785LR large subunit ribosomal RNA
            gene, partial sequence
          Length = 1160

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1124 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1072
>gb|AF373282.1|AF373282 Chaunopycnis pustulata clone MF5368LR large subunit ribosomal RNA
            gene, partial sequence
          Length = 1162

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1129 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1077
>gb|AF279395.1|AF279395 Hypocrea schweinitzii large subunit ribosomal RNA gene, partial
            sequence
          Length = 1224

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1097 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1045
>gb|AF213032.1|AF213032 Verticillium cf. fungicola 28S ribosomal RNA gene, partial sequence
          Length = 1345

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1123 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1071
>gb|AF213031.1|AF213031 Mycogone rosea 28S ribosomal RNA gene, partial sequence
          Length = 1340

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1118 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1066
>gb|AF213030.1|AF213030 Mycogone calospora 28S ribosomal RNA gene, partial sequence
          Length = 1189

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1123 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1071
>gb|AF160245.1|AF160245 Hypomyces sympodiophorus isolate CBS 403.86 28S ribosomal RNA gene,
            partial sequence
          Length = 1235

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1121 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1069
>gb|AF160244.1|AF160244 Hypomyces sympodiophorus isolate G.J.S. 95-167 28S ribosomal RNA
            gene, partial sequence
          Length = 1344

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1121 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1069
>gb|AF160241.1|AF160241 Hypomyces orthosporus 28S ribosomal RNA gene, partial sequence
          Length = 1344

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1121 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1069
>gb|AF160238.1|AF160238 Hypomyces mycophilus 28S ribosomal RNA gene, partial sequence
          Length = 1339

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1120 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1068
>gb|AF160237.1|AF160237 Hypomyces luteovirens 28S ribosomal RNA gene, partial sequence
          Length = 1346

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1125 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1073
>gb|AF160231.1|AF160231 Sphaerostilbella broomeana 28S ribosomal RNA gene, partial sequence
          Length = 1345

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1122 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1070
>gb|AF160229.1|AF160229 Cladobotryum stereicola 28S ribosomal RNA gene, partial sequence
          Length = 1347

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1124 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1072
>gb|AF213028.1|AF213028 Hypomyces completus 28S ribosomal RNA gene, partial sequence
          Length = 1345

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1123 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1071
>gb|AF019201.1|AF019201 Trichoderma virens 28S ribosomal RNA gene, partial sequence
          Length = 410

 Score = 73.8 bits (37), Expect = 2e-11
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 18  gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
           |||||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 204 gtactaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 152
>gb|AF431949.1| Cainia graminis strain CBS 136.62 28S ribosomal RNA gene, partial
            sequence
          Length = 1399

 Score = 71.9 bits (36), Expect = 9e-11
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            |||||||||||||||| || ||||||||| |||| |||||||||||||||||
Sbjct: 1172 gtactaacaccttttgtggtgtctgatgagcgtccactctggcaccttaacc 1121
>gb|AF279410.1|AF279410 Seynesia erumpens large subunit ribosomal RNA gene, partial sequence
          Length = 1223

 Score = 71.9 bits (36), Expect = 9e-11
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            |||||||||||||||| || ||||||||| |||| |||||||||||||||||
Sbjct: 1096 gtactaacaccttttgtggtgtctgatgagcgtccactctggcaccttaacc 1045
>gb|AF373286.1|AF373286 Tolypocladium inflatum large subunit ribosomal RNA gene, partial
            sequence
          Length = 1161

 Score = 69.9 bits (35), Expect = 3e-10
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||| ||||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1126 actaacgccttttgtggtgtctgatgagcgtctactctggcaccttaacct 1076
>gb|AF160236.1|AF160236 Hypomyces lateritius 28S ribosomal RNA gene, partial sequence
          Length = 1050

 Score = 69.9 bits (35), Expect = 3e-10
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 18  gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
           |||||||| ||||||| || ||||||||| ||||||||||||||| |||||||
Sbjct: 985 gtactaaccccttttgtggtgtctgatgagcgtctactctggcacyttaacct 933
>gb|AF104926.1|AF104926 Verticillium dahliae 18S ribosomal RNA gene, internal transcribed
            spacer 1, 5.8S ribosomal RNA gene, internal transcribed
            spacer 2, and 28S ribosomal RNA gene, complete sequence
          Length = 7216

 Score = 65.9 bits (33), Expect = 5e-09
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 4066 gtactaacaccttttgtggtgtctgatgagcgtccactccggcaccttaacct 4014
>gb|AF396876.1|AF396876 Halosarpheia unicellularis large subunit ribosomal RNA gene, partial
            sequence
          Length = 1361

 Score = 65.9 bits (33), Expect = 5e-09
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 22   taacaccttttgcggcgtctgatgaacgtctactctggcacctta 66
            |||||||||||| || ||||||||| |||||||||||||||||||
Sbjct: 1281 taacaccttttgtggtgtctgatgagcgtctactctggcacctta 1237
>gb|AF327388.1|AF327388 Torrubiella luteorostrata strain 2692 28S ribosomal RNA gene, partial
            sequence
          Length = 1339

 Score = 65.9 bits (33), Expect = 5e-09
 Identities = 49/53 (92%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| ||||||| |||||||||||||||
Sbjct: 1170 gtactaacaccttttgtggtgtctgatgagcgtctac-ctggcaccttaacct 1119
>gb|AF327384.1|AF327384 Cordyceps tuberculata 28S ribosomal RNA gene, partial sequence
          Length = 1330

 Score = 65.9 bits (33), Expect = 5e-09
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1159 gtactaacaccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1107
>gb|AF327381.1|AF327381 Hypocrella discoidea strain 4093 28S ribosomal RNA gene, partial
            sequence
          Length = 1345

 Score = 65.9 bits (33), Expect = 5e-09
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1181 gtactaacaccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1129
>gb|AF327376.1|AF327376 Cordyceps pseudomilitaris 28S ribosomal RNA gene, partial sequence
          Length = 1327

 Score = 65.9 bits (33), Expect = 5e-09
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1164 gtactaacaccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1112
>gb|AF327374.1|AF327374 Cordyceps militaris 28S ribosomal RNA gene, partial sequence
          Length = 1412

 Score = 65.9 bits (33), Expect = 5e-09
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1249 gtactaacaccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1197
>gb|AF213027.1|AF213027 Hypomyces chlorinigenus 28S ribosomal RNA gene, partial sequence
          Length = 1314

 Score = 65.9 bits (33), Expect = 5e-09
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| ||||||||| |||||||||||||
Sbjct: 1123 gtactaacgccttttgtggtgtctgatgagcgtctactccggcaccttaacct 1071
>emb|Z49794.1|CB26RRNA2 C.bifusispora gene for 26S ribosomal RNA
          Length = 636

 Score = 65.9 bits (33), Expect = 5e-09
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 18  gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
           |||||||||||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 543 gtactaacaccttttgtggtgtctgatgagcgtccactccggcaccttaacct 491
>gb|AF279374.1|AF279374 Aniptodera chesapeakensis large subunit ribosomal RNA gene, partial
            sequence
          Length = 1220

 Score = 63.9 bits (32), Expect = 2e-08
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            |||||||| ||||||| || ||||||||| |||| |||||||||||||||||
Sbjct: 1093 gtactaacgccttttgtggtgtctgatgagcgtccactctggcaccttaacc 1042
>gb|AF213029.1|AF213029 Hypomyces corticiicola 28S ribosomal RNA gene, partial sequence
          Length = 1122

 Score = 63.9 bits (32), Expect = 2e-08
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 19   tactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            ||||||| ||||||| ||  |||||||| |||||||||||||||||||||||
Sbjct: 1122 tactaaccccttttgtggtctctgatgagcgtctactctggcaccttaacct 1071
>gb|AF327387.1|AF327387 Hypocrella discoidea strain 2630 28S ribosomal RNA gene, partial
            sequence
          Length = 1285

 Score = 61.9 bits (31), Expect = 8e-08
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaac 68
            |||||||||||||||| || ||||||||| |||| |||| |||||||||||
Sbjct: 1166 gtactaacaccttttgtggtgtctgatgagcgtccactccggcaccttaac 1116
>gb|AF160243.1|AF160243 Hypomyces stephanomatis 28S ribosomal RNA gene, partial sequence
          Length = 1234

 Score = 61.9 bits (31), Expect = 8e-08
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                       
Query: 28   cttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||| || ||||||||| |||||||||||||||||||||||
Sbjct: 1104 cttttgtggtgtctgatgagcgtctactctggcaccttaacct 1062
>gb|AF431950.1| Cephalotheca sulfurea strain CBS 135.34 28S ribosomal RNA gene,
            partial sequence
          Length = 1295

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 22   taacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1063 taacaccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1015
>gb|AF113137.1|AF113137 Eremothecium gossypii 5S ribosomal RNA, 18S ribosomal RNA genes,
            internal transcribed spacer 1, 5.8S ribosomal RNA gene,
            internal transcribed spacer 2, and 25S ribosomal RNA
            gene, complete sequence
          Length = 8197

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaac 68
            |||||||||||||| || ||||||||| ||| || ||||||||||||||
Sbjct: 5058 actaacaccttttgtggtgtctgatgagcgtgtattctggcaccttaac 5010
>gb|AF327390.1|AF327390 Cordyceps sphecocephala strain 4169 28S ribosomal RNA gene, partial
            sequence
          Length = 1384

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1188 gtactaacgccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1136
>gb|AF327389.1|AF327389 Cordyceps irangiensis strain 3450 28S ribosomal RNA gene, partial
            sequence
          Length = 1367

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1194 gtactaacgccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1142
>gb|AF327386.1|AF327386 Aschersonia badia 28S ribosomal RNA gene, partial sequence
          Length = 1341

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||||| || ||||||||| ||||  ||| |||||||||||||
Sbjct: 1179 gtactaacaccttttgtggtgtctgatgagcgtccgctccggcaccttaacct 1127
>gb|AF327385.1|AF327385 Akanthomyces arachnophilus 28S ribosomal RNA gene, partial sequence
          Length = 1300

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||| ||||||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1156 gtaccaacaccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1104
>gb|AF327383.1|AF327383 Akanthomyces novoguineensis 28S ribosomal RNA gene, partial sequence
          Length = 1300

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||| ||||||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1156 gtaccaacaccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1104
>gb|AF327382.1|AF327382 Cordyceps cylindrica strain 3076 28S ribosomal RNA gene, partial
            sequence
          Length = 1321

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 48/53 (90%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| ||||||| |||||||||||||||
Sbjct: 1152 gtactaacgccttttgtggtgtctgatgagcgtctac-ctggcaccttaacct 1101
>gb|AF327379.1|AF327379 Cordyceps sphecocephala strain 4018 28S ribosomal RNA gene, partial
            sequence
          Length = 1333

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1190 gtactaacgccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1138
>gb|AF327378.1|AF327378 Cordyceps irangiensis strain 3938 28S ribosomal RNA gene, partial
            sequence
          Length = 1362

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1190 gtactaacgccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1138
>gb|AF327377.1|AF327377 Cordyceps cylindrica strain 2347 28S ribosomal RNA gene, partial
            sequence
          Length = 1278

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||| ||||||| || ||||||||| |||| |||| |||||||||||||
Sbjct: 1145 gtactaacgccttttgtggtgtctgatgagcgtccactccggcaccttaacct 1093
>gb|AF178565.1|AF178565 Chaetosphaeria aterrima 28S ribosomal RNA gene, partial sequence
          Length = 1178

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 38   gtctgatgaacgtctactctggcaccttaacct 70
            ||||||||| |||||||||||||||||||||||
Sbjct: 1174 gtctgatgagcgtctactctggcaccttaacct 1142
>gb|AF178560.1|AF178560 Cylindrotrichum hennebertii internal transcribed spacer 1, 5.8S
            ribosomal RNA gene and internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1644

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 38   gtctgatgaacgtctactctggcaccttaacct 70
            ||||||||| |||||||||||||||||||||||
Sbjct: 1640 gtctgatgagcgtctactctggcaccttaacct 1608
>gb|AF178547.1|AF178547 Chaetosphaeria tulasneorum internal transcribed spacer 1, 5.8S
            ribosomal RNA gene and internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1642

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 38   gtctgatgaacgtctactctggcaccttaacct 70
            ||||||||| |||||||||||||||||||||||
Sbjct: 1638 gtctgatgagcgtctactctggcaccttaacct 1606
>gb|AF218207.1|AF218207 Metarhizium anisopliae small subunit ribosomal RNA gene, internal
            transcribed spacer 1, 5.8S ribosomal RNA gene, internal
            transcribed spacer 2, and large subunit ribosomal RNA
            gene, complete sequence
          Length = 8118

 Score = 58.0 bits (29), Expect = 1e-06
 Identities = 48/53 (90%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                 
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| | || || |||||| |||||||||||||||||||||||
Sbjct: 3464 gtactaacacctttggtggtgt-tgatgagcgtctactctggcaccttaacct 3413
>gb|AF362557.1|AF362557 Gaeumannomyces graminis var. graminis isolate AR3401 28S ribosomal
            RNA gene, partial sequence
          Length = 1740

 Score = 56.0 bits (28), Expect = 5e-06
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            |||||||| ||||||| || ||||||||| |||| |||| ||||||||||||
Sbjct: 1143 gtactaacgccttttgtggtgtctgatgagcgtccactccggcaccttaacc 1092
>gb|AF362556.1|AF362556 Gaeumannomyces graminis var. avenae isolate AR3400 28S ribosomal RNA
            gene, partial sequence
          Length = 1740

 Score = 56.0 bits (28), Expect = 5e-06
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            |||||||| ||||||| || ||||||||| |||| |||| ||||||||||||
Sbjct: 1143 gtactaacgccttttgtggtgtctgatgagcgtccactccggcaccttaacc 1092
>gb|AF362554.1|AF362554 Magnaporthe grisea isolate AR3390 28S ribosomal RNA gene, partial
            sequence
          Length = 1741

 Score = 56.0 bits (28), Expect = 5e-06
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            |||||||| ||||||| || ||||||||| |||| |||| ||||||||||||
Sbjct: 1144 gtactaacgccttttgtggtgtctgatgagcgtccactccggcaccttaacc 1093
>gb|AF178564.1|AF178564 Chaetosphaeria inaequalis internal transcribed spacer 1, 5.8S
            ribosomal RNA gene and internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1613

 Score = 56.0 bits (28), Expect = 5e-06
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 38   gtctgatgaacgtctactctggcaccttaacc 69
            ||||||||| ||||||||||||||||||||||
Sbjct: 1609 gtctgatgagcgtctactctggcaccttaacc 1578
>gb|AF178563.1|AF178563 Porosphaerella cordanophora internal transcribed spacer 1, 5.8S
            ribosomal RNA gene and internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1651

 Score = 56.0 bits (28), Expect = 5e-06
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 38   gtctgatgaacgtctactctggcaccttaacc 69
            ||||||||| ||||||||||||||||||||||
Sbjct: 1647 gtctgatgagcgtctactctggcaccttaacc 1616
>gb|AF178550.1|AF178550 Chaetosphaeria vermicularioides internal transcribed spacer 1, 5.8S
            ribosomal RNA gene and internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1651

 Score = 56.0 bits (28), Expect = 5e-06
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 38   gtctgatgaacgtctactctggcaccttaacc 69
            ||||||||| ||||||||||||||||||||||
Sbjct: 1647 gtctgatgagcgtctactctggcaccttaacc 1616
>dbj|AB026819.1|AB026819 Magnaporthe grisea genes for 18S rRNA, 5.8S rRNA, 26S rRNA, complete
            sequence, rDNA repeat unit sequence
          Length = 8412

 Score = 56.0 bits (28), Expect = 5e-06
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 18   gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            |||||||| ||||||| || ||||||||| |||| |||| ||||||||||||
Sbjct: 3846 gtactaacgccttttgtggtgtctgatgagcgtccactccggcaccttaacc 3795
>emb|Z49789.1|CG26RRNA2 C.globosum gene for 26S ribosomal RNA
          Length = 637

 Score = 56.0 bits (28), Expect = 5e-06
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 18  gtactaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
           |||||||| ||||||| || ||||||||| |||| |||| ||||||||||||
Sbjct: 544 gtactaacgccttttgtggtgtctgatgagcgtccactccggcaccttaacc 493
>gb|AF431951.1| Sclerotinia sclerotiorum strain CBS 499.50 28S ribosomal RNA gene,
            partial sequence
          Length = 1699

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1473 actaacaccttttgtggtgtctgatgagcgtatattccggcaccttaacct 1423
>gb|AY038325.1| Inocybe sp. Trappe 25080 25S large subunit ribosomal RNA gene,
            partial sequence
          Length = 1325

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| |||  | ||||||||||||||||
Sbjct: 1233 actaacaccttttgtggtgtctgatgagcgtgaattctggcaccttaacct 1183
>gb|AF310101.1| Gloeocystidiellum porosum strain FCUG2734 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete
            sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 1677

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1528 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1478
>gb|AF310100.1| Gloeocystidiellum porosum strain FCUG2768 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete
            sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 1683

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1528 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1478
>gb|AF310099.1| Gloeocystidiellum porosum strain FCUG2661 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete
            sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 1696

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1534 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1484
>gb|AF310098.1| Gloeocystidiellum porosum specimen-voucher CBS27154 5.8S ribosomal
            RNA gene, partial sequence; internal transcribed spacer
            2, complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1674

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1532 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1482
>gb|AF310097.1| Gloeocystidiellum porosum specimen-voucher CBS51085 5.8S ribosomal
            RNA gene, partial sequence; internal transcribed spacer
            2, complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1691

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1529 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1479
>gb|AF310096.1| Gloeocystidiellum porosum strain FCUG2412 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete
            sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 1690

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1540 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1490
>gb|AF310093.1| Gloeocystidiellum porosum strain FCUG2435 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete
            sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 1638

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1543 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1493
>gb|AF310090.1| Gloeocystidiellum sp. NH12972 strain FCUG2679 5.8S ribosomal RNA
            gene, partial sequence; internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1706

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1544 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1494
>gb|AF310089.1| Gloeocystidiellum sp. NH13258 strain FCUG2766 5.8S ribosomal RNA
            gene, partial sequence; internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1680

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1525 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1475
>gb|AF310087.1| Gloeocystidiellum clavuligerum strain FCUG1091 5.8S ribosomal RNA
            gene, partial sequence; internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1635

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1521 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1471
>gb|AF310085.1| Gloeocystidiellum clavuligerum specimen-voucher JB16319 5.8S
            ribosomal RNA gene, partial sequence; internal
            transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 1612

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1450 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1400
>gb|AF310084.1| Gloeocystidiellum clavuligerum specimen-voucher JS16976 5.8S
            ribosomal RNA gene, partial sequence; internal
            transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 1714

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1566 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1516
>gb|AF310083.1| Gloeocystidiellum clavuligerum strain FCUG2731 5.8S ribosomal RNA
            gene, partial sequence; internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1685

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1551 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1501
>gb|AF310078.1| Gloeocystidiellum clavuligerum strain FCUG676 5.8S ribosomal RNA
            gene, partial sequence; internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1620

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1549 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1499
>gb|AF310077.1| Gloeocystidiellum clavuligerum strain FCUG677 5.8S ribosomal RNA
            gene, partial sequence; internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 1731

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1569 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1519
>gb|AF378367.1|AF378367 Peziza vesiculosa large subunit ribosomal RNA gene, partial sequence
          Length = 1189

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| |||  | ||||||||||||||||
Sbjct: 1173 actaacaccttttgtggtgtctgatgagcgtgcattctggcaccttaacct 1123
>gb|AY016360.1| Dothidea ribesia 28S ribosomal RNA gene, partial sequence
          Length = 1798

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1568 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1518
>gb|AY016359.1| Discosphaerina fagi 28S ribosomal RNA gene, partial sequence
          Length = 1409

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1179 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1129
>gb|AY016358.1| Delphinella strobiligena 28S ribosomal RNA gene, partial sequence
          Length = 1406

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 1180 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 1130
>gb|AF381555.1|AF381555 Melanaria sp. Printzen 1998 28S ribosomal RNA gene, partial sequence
          Length = 1536

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| |||| | || |||||||||||||
Sbjct: 1327 actaacaccttttgtggtgtctgatgagcgtccattccggcaccttaacct 1277
>gb|AF356652.1|AF356652 Filobasidiella neoformans var. neoformans 5S ribosomal RNA, 17S
            ribosomal RNA genes, internal transcribed spacer 1, 5.8S
            ribosomal RNA gene, internal transcribed spacer 2, and
            25S ribosomal RNA gene, complete sequence
          Length = 8275

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 20   actaacaccttttgcggcgtctgatgaacgtctactctggcaccttaacct 70
            |||||||||||||| || ||||||||| ||| || || |||||||||||||
Sbjct: 6125 actaacaccttttgtggtgtctgatgagcgtgtattccggcaccttaacct 6075
>gb|AF327391.1|AF327391 Torrubiella arachnophilus 28S ribosomal RNA gene, partial sequence
          Length = 1274

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 23   aacaccttttgcggcgtctgatgaacgtctactctggcaccttaacc 69
            ||||||||||| || ||||||||| |||| |||| ||||||||||||
Sbjct: 1153 aacaccttttgtggtgtctgatgagcgtccactccggcaccttaacc 1107
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) Posted date: May 13, 2002 3:54 AM Number of letters in database: 1,205,879,881 Number of sequences in database: 1,217,082 Lambda K H 1.37 0.711 0.00 Gapped Lambda K H 1.37 0.711 4.94e-324 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 83,609 Number of Sequences: 1217082 Number of extensions: 83609 Number of successful extensions: 5306 Number of sequences better than 10.0: 401 length of query: 86 length of database: 5,500,847,177 effective HSP length: 19 effective length of query: 67 effective length of database: 5,477,722,619 effective search space: 367007415473 effective search space used: 367007415473 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)